Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPEF1 cdna clone

PPEF1 cDNA Clone

Gene Names
PPEF1; PP7; PPEF; PPP7C; PPP7CA
Synonyms
PPEF1; PPEF1 cDNA Clone; PPEF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggatgcagcagttcttcaacgaaaaccaggagatctgacacatcactgagagctgcgttgatcatccagaactggtaccgaggttacaaagctcgactgaaggccagacaacactatgccctcaccatcttccagtccatcgaatatgctgatgaacaaggccaaatgcagttatccaccttcttttccttcatgttggaaaactacacacatatacataaggaagagctagaattaagaaatcagtctcttgaaagcgaacaggacatgagggatagatgggattatgtggactcgatagatgtcccagactcctataatggtcctcggctacaatttcctctcacttgtacggatattgatttacttcttgaggccttcaaggaacaacagatacttcatgcccattatgtcttagaggtgctatttgaaaccaagaaagtcctgaagcaaatgccgaatttcactcacatacaaacttctccctccaaagaggtaacaatctgtggtgatttgcatgggaaactggatgatctttttttgatcttctacaagaatggtctcccctcagagaggaacccgtatgtttttaatggtgactttgtagatcgaggaaagaattccatagagatcctaatgatcctgtgtgtgagttttcttgtctaccccaatgacctgcacttgaacagagggaaccacgaagattttatgatgaatctgaggtatggcttcacgaaagaaattttgcataaatataagctacatggaaaaagaatcttacaaatcttggaagaattctatgcctggctcccaatcggtacaatcgttgacaatgaaatcctggtcatccatggtgggatatcagagaccacagacttgaatttactccaccgtgtagagaggaacaagatgaaatctgtgctgataccaccaacggaaacaaacagagaccatgacactgactcgaagcacaataaagtaggtgtgacttttaatgcacatggaagaatcaaaacaaatggatctcctactgaacacttaacagagcatgaatgggaacagattattgatattctgtggagtgatcccagaggcaaaaatggctgttttccaaatacgtgccgaggagggggctgctattttggaccagatgttacttccaagattcttaataaataccagttgaagatgctcatcaggtctcatgaatgtaagcccgaagggtatgaaatctgtcatgatgggaaggtggtgactatattttctgcttctaattattatgaagaaggcagcaatcgaggagcttacatcaaactatgttctggtacaactcctcgatttttccagtaccaagtaactaaagcaacgtgctttcagcctcttcgccaaagagtggatactatggaaaacagcgccatcaagatattaagagagagagtgatttcacgaaaaagtgaccttactcgtgctttccaacttcaagaccacagaaaatcaggaaaactttctgtgagccagtgggctttttgcatggagaacattttggggctgaacttaccatggagatccctcagttcgaatctggtaaacatagaccaaaatggaaacgttgaatacatgtccagcttccagaatatccgcattgaaaaacctgtacaagaggctcattctactctagttgaaactctgtacagatacagatctgacctggaaatcatatttaatgccattgacactgatcactcaggcctgatctccgtggaagaatttcgtgccatgtggaaactttttagttctcactacaatgttcacattgatgattcccaagtcaataagcttgccaacataatggacttgaacaaagatggaagcattgactttaatgagtttttaaaggctttctatgtagtgcatagatatgaagacttgatgaaacctgatgtcaccaaccttggctaa
Sequence Length
1962
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,806 Da
NCBI Official Full Name
Homo sapiens protein phosphatase, EF-hand calcium binding domain 1, mRNA
NCBI Official Synonym Full Names
protein phosphatase with EF-hand domain 1
NCBI Official Symbol
PPEF1
NCBI Official Synonym Symbols
PP7; PPEF; PPP7C; PPP7CA
NCBI Protein Information
serine/threonine-protein phosphatase with EF-hands 1
UniProt Protein Name
Serine/threonine-protein phosphatase with EF-hands 1
UniProt Gene Name
PPEF1
UniProt Synonym Gene Names
PPEF; PPP7C; PPEF-1; PPEF; PP7
UniProt Entry Name
PPE1_HUMAN

NCBI Description

This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein has been suggested to play a role in specific sensory neuron function and/or development. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. Several alternatively spliced transcript variants, each encoding a distinct isoform, have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

PPEF-1: a Ser/Thr phosphatase. Contains at least two EF-hand calcium-binding motifs in its C terminus. May play a role in specific sensory neuron function and/or development. Shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. Several alternatively spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; Protein phosphatase, Ser/Thr (non-receptor); Protein phosphatase, dual-specificity; EC 3.1.3.16

Chromosomal Location of Human Ortholog: Xp22

Cellular Component: cytosol

Molecular Function: protein binding; protein serine/threonine phosphatase activity

Biological Process: protein amino acid dephosphorylation; regulation of rhodopsin mediated signaling

Research Articles on PPEF1

Similar Products

Product Notes

The PPEF1 ppef1 (Catalog #AAA1277229) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggatgca gcagttcttc aacgaaaacc aggagatctg acacatcact gagagctgcg ttgatcatcc agaactggta ccgaggttac aaagctcgac tgaaggccag acaacactat gccctcacca tcttccagtc catcgaatat gctgatgaac aaggccaaat gcagttatcc accttctttt ccttcatgtt ggaaaactac acacatatac ataaggaaga gctagaatta agaaatcagt ctcttgaaag cgaacaggac atgagggata gatgggatta tgtggactcg atagatgtcc cagactccta taatggtcct cggctacaat ttcctctcac ttgtacggat attgatttac ttcttgaggc cttcaaggaa caacagatac ttcatgccca ttatgtctta gaggtgctat ttgaaaccaa gaaagtcctg aagcaaatgc cgaatttcac tcacatacaa acttctccct ccaaagaggt aacaatctgt ggtgatttgc atgggaaact ggatgatctt tttttgatct tctacaagaa tggtctcccc tcagagagga acccgtatgt ttttaatggt gactttgtag atcgaggaaa gaattccata gagatcctaa tgatcctgtg tgtgagtttt cttgtctacc ccaatgacct gcacttgaac agagggaacc acgaagattt tatgatgaat ctgaggtatg gcttcacgaa agaaattttg cataaatata agctacatgg aaaaagaatc ttacaaatct tggaagaatt ctatgcctgg ctcccaatcg gtacaatcgt tgacaatgaa atcctggtca tccatggtgg gatatcagag accacagact tgaatttact ccaccgtgta gagaggaaca agatgaaatc tgtgctgata ccaccaacgg aaacaaacag agaccatgac actgactcga agcacaataa agtaggtgtg acttttaatg cacatggaag aatcaaaaca aatggatctc ctactgaaca cttaacagag catgaatggg aacagattat tgatattctg tggagtgatc ccagaggcaa aaatggctgt tttccaaata cgtgccgagg agggggctgc tattttggac cagatgttac ttccaagatt cttaataaat accagttgaa gatgctcatc aggtctcatg aatgtaagcc cgaagggtat gaaatctgtc atgatgggaa ggtggtgact atattttctg cttctaatta ttatgaagaa ggcagcaatc gaggagctta catcaaacta tgttctggta caactcctcg atttttccag taccaagtaa ctaaagcaac gtgctttcag cctcttcgcc aaagagtgga tactatggaa aacagcgcca tcaagatatt aagagagaga gtgatttcac gaaaaagtga ccttactcgt gctttccaac ttcaagacca cagaaaatca ggaaaacttt ctgtgagcca gtgggctttt tgcatggaga acattttggg gctgaactta ccatggagat ccctcagttc gaatctggta aacatagacc aaaatggaaa cgttgaatac atgtccagct tccagaatat ccgcattgaa aaacctgtac aagaggctca ttctactcta gttgaaactc tgtacagata cagatctgac ctggaaatca tatttaatgc cattgacact gatcactcag gcctgatctc cgtggaagaa tttcgtgcca tgtggaaact ttttagttct cactacaatg ttcacattga tgattcccaa gtcaataagc ttgccaacat aatggacttg aacaaagatg gaagcattga ctttaatgag tttttaaagg ctttctatgt agtgcataga tatgaagact tgatgaaacc tgatgtcacc aaccttggct aa. It is sometimes possible for the material contained within the vial of "PPEF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.