Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPARG cdna clone

PPARG cDNA Clone

Gene Names
PPARG; GLM1; CIMT1; NR1C3; PPARG1; PPARG2; PPARgamma
Synonyms
PPARG; PPARG cDNA Clone; PPARG cdna clone
Ordering
For Research Use Only!
Sequence
atgaccatggttgacacagagatgccattctggcccaccaactttgggatcagctccgtggatctctccgtaatggaagaccactcccactcctttgatatcaagcccttcactactgttgacttctccagcatttctactccacattacgaagacattccattcacaagaacagatccagtggttgcagattacaagtatgacctgaaacttcaagagtaccaaagtgcaatcaaagtggagcctgcatctccaccttattattctgagaagactcagctctacaataagcctcatgaagagccttccaactccctcatggcaattgaatgtcgtgtctgtggagataaagcttctggatttcactatggagttcatgcttgtgaaggatgcaagggtttcttccggagaacaatcagattgaagcttatctatgacagatgtgatcttaactgtcggatccacaaaaaaagtagaaataaatgtcagtactgtcggtttcagaaatgccttgcagtggggatgtctcataatgccatcaggtttgggcggatgccacaggccgagaaggagaagctgttggcggagatctccagtgatatcgaccagctgaatccagagtccgctgacctccgggccctggcaaaacatttgtatgactcatacataaagtccttcccgctgaccaaagcaaaggcgagggcgatcttgacaggaaagacaacagacaaatcaccattcgttatctatgacatgaattccttaatgatgggagaagataaaatcaagttcaaacacatcacccccctgcaggagcagagcaaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaaggacttgtactag
Sequence Length
1434
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,580 Da
NCBI Official Full Name
Homo sapiens peroxisome proliferator-activated receptor gamma, mRNA
NCBI Official Synonym Full Names
peroxisome proliferator activated receptor gamma
NCBI Official Symbol
PPARG
NCBI Official Synonym Symbols
GLM1; CIMT1; NR1C3; PPARG1; PPARG2; PPARgamma
NCBI Protein Information
peroxisome proliferator-activated receptor gamma
UniProt Protein Name
Peroxisome proliferator-activated receptor gamma
UniProt Gene Name
PPARG
UniProt Synonym Gene Names
NR1C3; PPAR-gamma
UniProt Entry Name
PPARG_HUMAN

NCBI Description

This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

PPAR-gamma: a transcription factor, member of the nuclear hormone receptor superfamily. Receptor for hypolipidemic drugs and fatty acids. Preferentially expressed in adipocytes as well as in vascular smooth muscle cells and macrophage. Regulator of adipogenesis and lipid metabolism, modulates insulin sensitivity, cell proliferation and inflammation. Phosphorylated and inhibited by MAP kinase. Heterodimerizes with the retinoid X receptor. Interacts with NCOA6 coactivator, leading to a strong increase in transcription of target genes. Two splice-variant isoforms have been described.

Protein type: Nuclear receptor; DNA-binding

Chromosomal Location of Human Ortholog: 3p25

Cellular Component: cytosol; Golgi apparatus; intracellular membrane-bound organelle; nucleoplasm; nucleus

Molecular Function: alpha-actinin binding; arachidonic acid binding; chromatin binding; DNA binding; drug binding; enzyme binding; identical protein binding; ligand-dependent nuclear receptor activity; ligand-dependent nuclear receptor transcription coactivator activity; prostaglandin receptor activity; protein binding; retinoid X receptor binding; sequence-specific DNA binding; transcription activator binding; transcription factor activity; transcription factor binding

Biological Process: caspase activation; cell fate commitment; cell maturation; cellular response to insulin stimulus; epithelial cell differentiation; glucose homeostasis; innate immune response; lipid homeostasis; lipid metabolic process; lipoprotein transport; long-chain fatty acid transport; low-density lipoprotein receptor biosynthetic process; monocyte differentiation; negative regulation of smooth muscle cell proliferation; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; placenta development; positive regulation of fat cell differentiation; positive regulation of transcription factor activity; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of blood pressure; regulation of circadian rhythm; response to lipid; response to low density lipoprotein stimulus; response to nutrient; response to retinoic acid; signal transduction; transcription initiation from RNA polymerase II promoter; white fat cell differentiation

Disease: Carotid Intimal Medial Thickness 1; Diabetes Mellitus, Noninsulin-dependent; Lipodystrophy, Familial Partial, Type 3; Obesity

Research Articles on PPARG

Similar Products

Product Notes

The PPARG pparg (Catalog #AAA1274820) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccatgg ttgacacaga gatgccattc tggcccacca actttgggat cagctccgtg gatctctccg taatggaaga ccactcccac tcctttgata tcaagccctt cactactgtt gacttctcca gcatttctac tccacattac gaagacattc cattcacaag aacagatcca gtggttgcag attacaagta tgacctgaaa cttcaagagt accaaagtgc aatcaaagtg gagcctgcat ctccacctta ttattctgag aagactcagc tctacaataa gcctcatgaa gagccttcca actccctcat ggcaattgaa tgtcgtgtct gtggagataa agcttctgga tttcactatg gagttcatgc ttgtgaagga tgcaagggtt tcttccggag aacaatcaga ttgaagctta tctatgacag atgtgatctt aactgtcgga tccacaaaaa aagtagaaat aaatgtcagt actgtcggtt tcagaaatgc cttgcagtgg ggatgtctca taatgccatc aggtttgggc ggatgccaca ggccgagaag gagaagctgt tggcggagat ctccagtgat atcgaccagc tgaatccaga gtccgctgac ctccgggccc tggcaaaaca tttgtatgac tcatacataa agtccttccc gctgaccaaa gcaaaggcga gggcgatctt gacaggaaag acaacagaca aatcaccatt cgttatctat gacatgaatt ccttaatgat gggagaagat aaaatcaagt tcaaacacat cacccccctg caggagcaga gcaaagaggt ggccatccgc atctttcagg gctgccagtt tcgctccgtg gaggctgtgc aggagatcac agagtatgcc aaaagcattc ctggttttgt aaatcttgac ttgaacgacc aagtaactct cctcaaatat ggagtccacg agatcattta cacaatgctg gcctccttga tgaataaaga tggggttctc atatccgagg gccaaggctt catgacaagg gagtttctaa agagcctgcg aaagcctttt ggtgacttta tggagcccaa gtttgagttt gctgtgaagt tcaatgcact ggaattagat gacagcgact tggcaatatt tattgctgtc attattctca gtggagaccg cccaggtttg ctgaatgtga agcccattga agacattcaa gacaacctgc tacaagccct ggagctccag ctgaagctga accaccctga gtcctcacag ctgtttgcca agctgctcca gaaaatgaca gacctcagac agattgtcac ggaacacgtg cagctactgc aggtgatcaa gaagacggag acagacatga gtcttcaccc gctcctgcag gagatctaca aggacttgta ctag. It is sometimes possible for the material contained within the vial of "PPARG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.