Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POR cdna clone

POR cDNA Clone

Gene Names
POR; CPR; CYPOR; P450R
Synonyms
POR; POR cDNA Clone; POR cdna clone
Ordering
For Research Use Only!
Sequence
atgatcaacatgggagactcccacgtggacaccagctccaccgtgtccgaggcggtggccgaagaagtatctcttttcagcatgacggacatgattctgttttcgctcatcgtgggtctcctaacctactggttcctcttcagaaagaaaaaagaagaagtccccgagttcaccaaaattcagacattgacctcctctgtcagagagagcagctttgtggaaaagatgaagaaaacggggaggaacatcatcgtgttctacggctcccagacggggactgcagaggagtttgccaaccgcctgtccaaggacgcccaccgctacgggatgcgaggcatgtcagcggaccctgaggagtatgacctggccgacctgagcagcctgccagagatcgacaacgccctggtggttttctgcatggccacctacggtgagggagaccccaccgacaatgcccaggacttctacgactggctgcaggagacagacgtggatctctctggggtcaagttcgcggtgtttggtcttgggaacaagacctacgagcacttcaatgccatgggcaagtacgtggacaagcggctggagcagctcggcgcccagcgcatctttgagctggggttgggcgacgacgatgggaacttggaggaggacttcatcacctggcgagagcagttctggctggccgtgtgtgaacactttggggtggaagccactggcgaggagtccagcattcgccagtacgagcttgtggtccacaccgacatagatgcggccaaggtgtacatgggggagatgggccggctgaagagctacgagaaccagaagcccccctttgatgccaagaatccgttcctggctgcagtcaccaccaaccggaagctgaaccagggaaccgagcgccacctcatgcacctggaattggacatctcggactccaaaatcaggtatgaatctggggaccacgtggctgtgtacccagccaacgactctgctctcgtcaaccagctgggcaaaatcctgggtgccgacctggacgtcgtcatgtccctgaacaacctggatgaggagtccaacaagaagcacccattcccgtgccctacgtcctaccgcacggccctcacctactacctggacatcaccaacccgccgcgtaccaacgtgctgtacgagctggcgcagtacgcctcggagccctcggagcaggagctgctgcgcaagatggcctcctcctccggcgagggcaaggagctgtacctgagctgggtggtggaggcccggaggcacatcctggccatcctgcaggactgcccgtccctgcggccccccatcgaccacctgtgtgagctgctgccgcgcctgcaggcccgctactactccatcgcctcatcctccaaggtccaccccaactctgtgcacatctgtgcggtggttgtggagtacgagaccaaggccggccgcatcaacaagggcgtggccaccaactggctgcgggccaaggagcctgtcggggagaacggcggccgtgcgctggtgcccatgttcgtgcgcaagtcccagttccgcctgcccttcaaggccaccacgcctgtcatcatggtgggccccggcaccggggtggcacccttcataggcttcatccaggagcgggcctggctgcgacagcagggcaaggaggtgggggagacgctgctgtactacggctgccgccgctcggatgaggactacctgtaccgggaggagctggcgcagttccacagggacggtgcgctcacccagctcaacgtggccttctcccgggagcagtcccacaaggtctacgtccagcacctgctaaagcaagaccgagagcacctgtggaagttgatcgaaggcggtgcccacatctacgtctgtggggatgcacggaacatggccagggatgtgcagaacaccttctacgacatcgtggctgagctcggggccatggagcacgcgcaggcggtggactacatcaagaaactgatgaccaagggccgctactccctggacgtgtggagctag
Sequence Length
2043
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
76,690 Da
NCBI Official Full Name
Homo sapiens P450 (cytochrome) oxidoreductase, mRNA
NCBI Official Synonym Full Names
cytochrome p450 oxidoreductase
NCBI Official Symbol
POR
NCBI Official Synonym Symbols
CPR; CYPOR; P450R
NCBI Protein Information
NADPH--cytochrome P450 reductase
UniProt Protein Name
NADPH--cytochrome P450 reductase
Protein Family
UniProt Gene Name
POR
UniProt Synonym Gene Names
CPR; P450R
UniProt Entry Name
NCPR_HUMAN

NCBI Description

This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome. [provided by RefSeq, Jul 2008]

Uniprot Description

POR: This enzyme is required for electron transfer from NADP to cytochrome P450 in microsomes. It can also provide electron transfer to heme oxygenase and cytochrome B5. Defects in POR are the cause of Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis (ABS1). A disease characterized by the association of Antley-Bixler syndrome with steroidogenesis defects and abnormal genitalia. Antley-Bixler syndrome is characterized by craniosynostosis, radiohumeral synostosis present from the perinatal period, midface hypoplasia, choanal stenosis or atresia, femoral bowing and multiple joint contractures. Defects in POR are the cause of disordered steroidogenesis due to cytochrome P450 oxidoreductase deficiency (DISPORD). A disorder resulting in a rare variant of congenital adrenal hyperplasia, with apparent combined P450C17 and P450C21 deficiency and accumulation of steroid metabolites. Affected girls are born with ambiguous genitalia, but their circulating androgens are low and virilization does not progress. Conversely, affected boys are sometimes born undermasculinized. Boys and girls can present with bone malformations, in some cases resembling the pattern seen in patients with Antley-Bixler syndrome.

Protein type: EC 1.6.2.4; Endoplasmic reticulum; Oxidoreductase; Mitochondrial

Chromosomal Location of Human Ortholog: 7q11.2

Cellular Component: endoplasmic reticulum membrane; intracellular membrane-bound organelle; membrane

Molecular Function: [methionine synthase] reductase activity; NADPH-hemoprotein reductase activity; protein binding

Biological Process: positive regulation of monooxygenase activity; xenobiotic metabolic process

Disease: Antley-bixler Syndrome With Genital Anomalies And Disordered Steroidogenesis; Antley-bixler Syndrome Without Genital Anomalies Or Disordered Steroidogenesis; Disordered Steroidogenesis Due To Cytochrome P450 Oxidoreductase Deficiency

Research Articles on POR

Similar Products

Product Notes

The POR por (Catalog #AAA7046756) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcaaca tgggagactc ccacgtggac accagctcca ccgtgtccga ggcggtggcc gaagaagtat ctcttttcag catgacggac atgattctgt tttcgctcat cgtgggtctc ctaacctact ggttcctctt cagaaagaaa aaagaagaag tccccgagtt caccaaaatt cagacattga cctcctctgt cagagagagc agctttgtgg aaaagatgaa gaaaacgggg aggaacatca tcgtgttcta cggctcccag acggggactg cagaggagtt tgccaaccgc ctgtccaagg acgcccaccg ctacgggatg cgaggcatgt cagcggaccc tgaggagtat gacctggccg acctgagcag cctgccagag atcgacaacg ccctggtggt tttctgcatg gccacctacg gtgagggaga ccccaccgac aatgcccagg acttctacga ctggctgcag gagacagacg tggatctctc tggggtcaag ttcgcggtgt ttggtcttgg gaacaagacc tacgagcact tcaatgccat gggcaagtac gtggacaagc ggctggagca gctcggcgcc cagcgcatct ttgagctggg gttgggcgac gacgatggga acttggagga ggacttcatc acctggcgag agcagttctg gctggccgtg tgtgaacact ttggggtgga agccactggc gaggagtcca gcattcgcca gtacgagctt gtggtccaca ccgacataga tgcggccaag gtgtacatgg gggagatggg ccggctgaag agctacgaga accagaagcc cccctttgat gccaagaatc cgttcctggc tgcagtcacc accaaccgga agctgaacca gggaaccgag cgccacctca tgcacctgga attggacatc tcggactcca aaatcaggta tgaatctggg gaccacgtgg ctgtgtaccc agccaacgac tctgctctcg tcaaccagct gggcaaaatc ctgggtgccg acctggacgt cgtcatgtcc ctgaacaacc tggatgagga gtccaacaag aagcacccat tcccgtgccc tacgtcctac cgcacggccc tcacctacta cctggacatc accaacccgc cgcgtaccaa cgtgctgtac gagctggcgc agtacgcctc ggagccctcg gagcaggagc tgctgcgcaa gatggcctcc tcctccggcg agggcaagga gctgtacctg agctgggtgg tggaggcccg gaggcacatc ctggccatcc tgcaggactg cccgtccctg cggcccccca tcgaccacct gtgtgagctg ctgccgcgcc tgcaggcccg ctactactcc atcgcctcat cctccaaggt ccaccccaac tctgtgcaca tctgtgcggt ggttgtggag tacgagacca aggccggccg catcaacaag ggcgtggcca ccaactggct gcgggccaag gagcctgtcg gggagaacgg cggccgtgcg ctggtgccca tgttcgtgcg caagtcccag ttccgcctgc ccttcaaggc caccacgcct gtcatcatgg tgggccccgg caccggggtg gcacccttca taggcttcat ccaggagcgg gcctggctgc gacagcaggg caaggaggtg ggggagacgc tgctgtacta cggctgccgc cgctcggatg aggactacct gtaccgggag gagctggcgc agttccacag ggacggtgcg ctcacccagc tcaacgtggc cttctcccgg gagcagtccc acaaggtcta cgtccagcac ctgctaaagc aagaccgaga gcacctgtgg aagttgatcg aaggcggtgc ccacatctac gtctgtgggg atgcacggaa catggccagg gatgtgcaga acaccttcta cgacatcgtg gctgagctcg gggccatgga gcacgcgcag gcggtggact acatcaagaa actgatgacc aagggccgct actccctgga cgtgtggagc tag. It is sometimes possible for the material contained within the vial of "POR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.