POPDC2 cdna clone
POPDC2 cDNA Clone
Gene Names
POPDC2; POP2
Synonyms
POPDC2; POPDC2 cDNA Clone; POPDC2 cdna clone
Sequence
atggactctcctgagtgggaatcactacagccttctgaggagggggtgttccaggtcactctgactgctgagacctcatgtagctacatttcctggccccggaaaagtctccatcttcttctgaccaaagagcgatacatctcctgcctcttctcggctctgctgggatatgacatctcggagaagctctacactctcaatgacaagctctttgctaagtttgggctgcgctttgacatccgccttcccagcctctaccatgtcctgggtcccactgctgcagatgctggaccagagtccgagaagggtgatgaggaagtctgtgagccagctgtgtcccctcctcaggccacacccacctctctccagcaaacacccccttgttctacccctccagctaccaccaactttcctgcacctcctacccgggccaggttgtccaggccagacagtggcatactggagatagatgattttccctcttatttccaccagtttggcttttcagggaaggtggcagctggcagaatcccctga
Sequence Length
537
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
40,115 Da
NCBI Official Full Name
Homo sapiens popeye domain containing 2, mRNA
NCBI Official Synonym Full Names
popeye domain containing 2
NCBI Official Symbol
POPDC2
NCBI Official Synonym Symbols
POP2
NCBI Protein Information
popeye domain-containing protein 2
UniProt Protein Name
Popeye domain-containing protein 2
Protein Family
UniProt Gene Name
POPDC2
UniProt Synonym Gene Names
POP2; Popeye protein 2
UniProt Entry Name
POPD2_HUMAN
NCBI Description
This gene encodes a member of the POP family of proteins which contain three putative transmembrane domains. This membrane associated protein is predominantly expressed in skeletal and cardiac muscle, and may have an important function in these tissues. [provided by RefSeq, Jul 2008]
Uniprot Description
POPDC2: May play an important role in heart development. Belongs to the popeye family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 3q13.33
Cellular Component: sarcolemma
Biological Process: regulation of heart rate
Similar Products
Product Notes
The POPDC2 popdc2 (Catalog #AAA1270617) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactctc ctgagtggga atcactacag ccttctgagg agggggtgtt ccaggtcact ctgactgctg agacctcatg tagctacatt tcctggcccc ggaaaagtct ccatcttctt ctgaccaaag agcgatacat ctcctgcctc ttctcggctc tgctgggata tgacatctcg gagaagctct acactctcaa tgacaagctc tttgctaagt ttgggctgcg ctttgacatc cgccttccca gcctctacca tgtcctgggt cccactgctg cagatgctgg accagagtcc gagaagggtg atgaggaagt ctgtgagcca gctgtgtccc ctcctcaggc cacacccacc tctctccagc aaacaccccc ttgttctacc cctccagcta ccaccaactt tcctgcacct cctacccggg ccaggttgtc caggccagac agtggcatac tggagataga tgattttccc tcttatttcc accagtttgg cttttcaggg aaggtggcag ctggcagaat cccctga. It is sometimes possible for the material contained within the vial of "POPDC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
