Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POMT2 cdna clone

POMT2 cDNA Clone

Gene Names
POMT2; LGMD2N; MDDGA2; MDDGB2; MDDGC2
Synonyms
POMT2; POMT2 cDNA Clone; POMT2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgccggccacgggcggaggcctggcagagtccgagctgcgtccccggaggggccgctgtggcccccaggctgctagggccgcaggccgggacgtggccgctgaggctgtggcgcgaagccccaaacggcctgcttggggctcacggcgcttcgaggctgtcggctggtgggccctgctggccttggtgacgctgctgtccttcgccacccgcttccaccgcttggacgagccgccgcacatctgttgggatgagactcactttggaaaaatgggaagttactatatcaaccgtacatttttctttgatgtgcacccgcccctgggaaagatgctgataggtcttgctggctacctgagtggatatgatggtacctttttgttccagaagcctggggataaatatgagcatcacagctacatgggaatgagaggattctgtgcattccttggctcctggctggtcccctttgcctacctcactgtactggatctgtccaagtccctctcggcagcactgctcacagctgccctcctcacctttgacacgggatgcctcactctgtcccagtacatcctccttgaccccatcctgatgttcttcatcatggctgccatgctgagcatggtcaagtacaactcttgcgccgacaggcccttctctgccccctggtggttctggctcagcctgactggcgttagtcttgctggtgctttaggggtcaagtttgttggcctctttatcatccttcaagtggggctgaacaccattgcagacctttggtacctgttcggagacctcagtctttcattggtgactgtgggaaaacacctgactgctcgtgtcctgtgcctcatagtgctgcccctggctctctatacagccacctttgctgttcacttcatggtgctgagtaaaagtggccctggtgacggtttcttcagttctgccttccaggcccggctttcagggaacaacctgcacaatgcttccatccctgaacacctggcctacggctctgtgatcactgtgaagaacctccggatggccatcggctatctgcactcccacaggcacctctaccccgagggcattggtgcccgtcagcagcaggtcaccacctatttgcacaaggactacaacaacctgtggattatcaagaaacataacacaaactcagatcccctagacccttccttcccagtggagtttgtaagacatggagacattattcgactagaacacaaagaaacttcccggaacttgcacagtcactatcatgaggcccccatgacccggaagcactatcaggtcaccggctatggcataaatggaacaggggactcaaatgatttctggcggattgaggtcgtaaacagaaaatttggaaaccggatcaaagtgctgagaagtcgaattcgcttcatccatttggtcacaggttgtgtcctgggctcctcgggaaaggttctgcccaagtggggctgggagcagttggaagttacttgcaccccatacctgaaagaaaccctcaactccatctggaatgtggaggaccatatcaatcccaagttgccaaacatcagcctggatgtgctacagcccagttttcctgagatcttgctggaatcccacatggtcatgatccgggggaacagtggcctcaaacccaaggacaatgagttcacgtccaaaccctggcactggcctatcaactatcagggcctacgcttctcaggggtcaatgacacagatttccgagtctatctgcttggcaacccggtggtttggtggctgaatctgttgagcatcgccctctacctcctctcagggagcatcattgctgtagccatgcagagaggggcacggctgccagcggaggttgcagggttgtcccaggtcctgctgcgaggaggcggccaggtcctgctcggctggacactccattacttcccgtttttcctgatgggccgggtcctctacttccaccactacttcccagccatgctcttctcaagcatgttgacaggcattctgtgggacaccctcctgcggctctgtgcctggggcttggcctcatggcccctggcgaggggcatacatgtggcgggaatcctgagcctgctcctgggaactgcctacagcttctacctcttccaccctctggcttacgggatggttggtcccctggcccaggacccccaaagtccaatggcaggactaaggtggctggactcatgggacttttga
Sequence Length
2253
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,899 Da
NCBI Official Full Name
Homo sapiens protein-O-mannosyltransferase 2, mRNA
NCBI Official Synonym Full Names
protein O-mannosyltransferase 2
NCBI Official Symbol
POMT2
NCBI Official Synonym Symbols
LGMD2N; MDDGA2; MDDGB2; MDDGC2
NCBI Protein Information
protein O-mannosyl-transferase 2
UniProt Protein Name
Protein O-mannosyl-transferase 2
UniProt Gene Name
POMT2
UniProt Entry Name
POMT2_HUMAN

NCBI Description

The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT1 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS).[provided by RefSeq, Oct 2008]

Uniprot Description

POMT2: Transfers mannosyl residues to the hydroxyl group of serine or threonine residues. Coexpression of both POMT1 and POMT2 is necessary for enzyme activity, expression of either POMT1 or POMT2 alone is insufficient. Defects in POMT2 are the cause of muscular dystrophy- dystroglycanopathy congenital with brain and eye anomalies type A2 (MDDGA2); also called Walker-Warburg syndrome or muscle-eye-brain disease POMT2-related. MDDGA2 is a autosomal recessive disorder characterized by congenital muscular dystrophy associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. Defects in POMT2 are the cause of muscular dystrophy- dystroglycanopathy congenital with mental retardation type B2 (MDDGB2); also called muscular dystrophy congenital POMT2-related. MDDGB2 is an autosomal recessive disorder characterized by congenital muscular dystrophy associated with mental retardation and mild structural brain abnormalities. Defects in POMT2 are the cause of muscular dystrophy- dystroglycanopathy limb-girdle type C2 (MDDGC2); also called limb-girdle muscular dystrophy type 2N (LGMD2N) or muscular dystrophy-dystroglycanopathy limb-girdle POMT2-related (MDGD2C). MDDGC2 is an autosomal recessive muscular dystrophy with onset after ambulation is achieved. MDDGC2 is characterized by increased serum creatine kinase and mild muscle weakness. Muscle biopsy shows dystrophic changes, inflammatory changes, and severely decreased alpha-dystroglycan. Cognition is normal. Belongs to the glycosyltransferase 39 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Transferase; Membrane protein, multi-pass; Endoplasmic reticulum; Glycan Metabolism - O-mannosyl glycan biosynthesis; EC 2.4.1.109

Chromosomal Location of Human Ortholog: 14q24

Cellular Component: endoplasmic reticulum membrane

Molecular Function: dolichyl-phosphate-mannose-protein mannosyltransferase activity

Biological Process: cell wall mannoprotein biosynthetic process; multicellular organismal development; protein amino acid O-linked glycosylation

Disease: Muscular Dystrophy-dystroglycanopathy (congenital With Brain And Eye Anomalies), Type A, 1; Muscular Dystrophy-dystroglycanopathy (congenital With Brain And Eye Anomalies), Type A, 2; Muscular Dystrophy-dystroglycanopathy (congenital With Mental Retardation), Type B, 2; Muscular Dystrophy-dystroglycanopathy (limb-girdle), Type C, 2

Research Articles on POMT2

Similar Products

Product Notes

The POMT2 pomt2 (Catalog #AAA1275618) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgccgg ccacgggcgg aggcctggca gagtccgagc tgcgtccccg gaggggccgc tgtggccccc aggctgctag ggccgcaggc cgggacgtgg ccgctgaggc tgtggcgcga agccccaaac ggcctgcttg gggctcacgg cgcttcgagg ctgtcggctg gtgggccctg ctggccttgg tgacgctgct gtccttcgcc acccgcttcc accgcttgga cgagccgccg cacatctgtt gggatgagac tcactttgga aaaatgggaa gttactatat caaccgtaca tttttctttg atgtgcaccc gcccctggga aagatgctga taggtcttgc tggctacctg agtggatatg atggtacctt tttgttccag aagcctgggg ataaatatga gcatcacagc tacatgggaa tgagaggatt ctgtgcattc cttggctcct ggctggtccc ctttgcctac ctcactgtac tggatctgtc caagtccctc tcggcagcac tgctcacagc tgccctcctc acctttgaca cgggatgcct cactctgtcc cagtacatcc tccttgaccc catcctgatg ttcttcatca tggctgccat gctgagcatg gtcaagtaca actcttgcgc cgacaggccc ttctctgccc cctggtggtt ctggctcagc ctgactggcg ttagtcttgc tggtgcttta ggggtcaagt ttgttggcct ctttatcatc cttcaagtgg ggctgaacac cattgcagac ctttggtacc tgttcggaga cctcagtctt tcattggtga ctgtgggaaa acacctgact gctcgtgtcc tgtgcctcat agtgctgccc ctggctctct atacagccac ctttgctgtt cacttcatgg tgctgagtaa aagtggccct ggtgacggtt tcttcagttc tgccttccag gcccggcttt cagggaacaa cctgcacaat gcttccatcc ctgaacacct ggcctacggc tctgtgatca ctgtgaagaa cctccggatg gccatcggct atctgcactc ccacaggcac ctctaccccg agggcattgg tgcccgtcag cagcaggtca ccacctattt gcacaaggac tacaacaacc tgtggattat caagaaacat aacacaaact cagatcccct agacccttcc ttcccagtgg agtttgtaag acatggagac attattcgac tagaacacaa agaaacttcc cggaacttgc acagtcacta tcatgaggcc cccatgaccc ggaagcacta tcaggtcacc ggctatggca taaatggaac aggggactca aatgatttct ggcggattga ggtcgtaaac agaaaatttg gaaaccggat caaagtgctg agaagtcgaa ttcgcttcat ccatttggtc acaggttgtg tcctgggctc ctcgggaaag gttctgccca agtggggctg ggagcagttg gaagttactt gcaccccata cctgaaagaa accctcaact ccatctggaa tgtggaggac catatcaatc ccaagttgcc aaacatcagc ctggatgtgc tacagcccag ttttcctgag atcttgctgg aatcccacat ggtcatgatc cgggggaaca gtggcctcaa acccaaggac aatgagttca cgtccaaacc ctggcactgg cctatcaact atcagggcct acgcttctca ggggtcaatg acacagattt ccgagtctat ctgcttggca acccggtggt ttggtggctg aatctgttga gcatcgccct ctacctcctc tcagggagca tcattgctgt agccatgcag agaggggcac ggctgccagc ggaggttgca gggttgtccc aggtcctgct gcgaggaggc ggccaggtcc tgctcggctg gacactccat tacttcccgt ttttcctgat gggccgggtc ctctacttcc accactactt cccagccatg ctcttctcaa gcatgttgac aggcattctg tgggacaccc tcctgcggct ctgtgcctgg ggcttggcct catggcccct ggcgaggggc atacatgtgg cgggaatcct gagcctgctc ctgggaactg cctacagctt ctacctcttc caccctctgg cttacgggat ggttggtccc ctggcccagg acccccaaag tccaatggca ggactaaggt ggctggactc atgggacttt tga. It is sometimes possible for the material contained within the vial of "POMT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.