Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POM121C cdna clone

POM121C cDNA Clone

Gene Names
POM121C; POM121-2
Synonyms
POM121C; POM121C cDNA Clone; POM121C cdna clone
Ordering
For Research Use Only!
Sequence
atgaacacattgcaggggccagtgtcattcaaagatgtggctgtggatttcacccaggaggagtggcggcaactggaccctgatgagaagataacatacggggatgtgatgttggagaactacagccatctagtttccttggcttatgaggtggcaacatcttgtacttcggagattctgaagccgagcaacttgcccaagtccttcttcttttcccattaa
Sequence Length
222
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
99,134 Da
NCBI Official Full Name
Homo sapiens POM121 membrane glycoprotein C, mRNA
NCBI Official Synonym Full Names
POM121 transmembrane nucleoporin C
NCBI Official Symbol
POM121C
NCBI Official Synonym Symbols
POM121-2
NCBI Protein Information
nuclear envelope pore membrane protein POM 121C
UniProt Protein Name
Nuclear envelope pore membrane protein POM 121C
UniProt Gene Name
POM121C
UniProt Synonym Gene Names
POM121-2
UniProt Entry Name
P121C_HUMAN

Uniprot Description

POM121C: Essential component of the nuclear pore complex (NPC). The repeat-containing domain may be involved in anchoring components of the pore complex to the pore membrane. When overexpressed in cells induces the formation of cytoplasmic annulate lamellae (AL). Belongs to the POM121 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 7q11.2

Cellular Component: nuclear envelope; nuclear pore

Molecular Function: nuclear localization sequence binding; nucleocytoplasmic transporter activity; protein binding; structural constituent of nuclear pore

Biological Process: mitotic nuclear envelope disassembly; mRNA export from nucleus; protein import into nucleus; protein sumoylation; RNA export from nucleus; RNA-mediated gene silencing; tRNA export from nucleus; viral reproduction; viral transcription

Similar Products

Product Notes

The POM121C pom121c (Catalog #AAA1272248) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacacat tgcaggggcc agtgtcattc aaagatgtgg ctgtggattt cacccaggag gagtggcggc aactggaccc tgatgagaag ataacatacg gggatgtgat gttggagaac tacagccatc tagtttcctt ggcttatgag gtggcaacat cttgtacttc ggagattctg aagccgagca acttgcccaa gtccttcttc ttttcccatt aa. It is sometimes possible for the material contained within the vial of "POM121C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.