POLR3GL cdna clone
POLR3GL cDNA Clone
Gene Names
POLR3GL; RPC32HOM; flj32422
Synonyms
POLR3GL; POLR3GL cDNA Clone; POLR3GL cdna clone
Sequence
atggccagccggggtgggggccggggtcgtggccggggccagttgaccttcaacgtggaggccgtgggcattgggaaaggggatgctttgcccccacccaccctgcagccttctccactcttccctcccttggagttccgcccagtacctttgccctcaggcgaggaaggggaatatgtcctggcactgaagcaagagctacgaggagccatgaggcagctcccctacttcatccggccagctgtccccaagagagatgtggagcgttattcagacaaatatcagatgtcaggtccgattgacaatgccatcgattggaaccctgattggcggcgtctaccccgggagctaaagatccgagtgcggaagctacagaaggaacggattacaattctgctccccaagaggccccctaagaccacagaagataaggaggaaacaatacagaaactagagaccctggagaagaaggaagaagaagtaacttcagaggaggatgaggagaaagaagaagaagaagagaaggaagaggaggaagaagaagagtatgatgaagaagaacatgaagaggaaactgattacatcatgtcatattttgacaatggagaggactttggtggtgacagtgatgacaatatggacgaggctatatactga
Sequence Length
657
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,334 Da
NCBI Official Full Name
Homo sapiens polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like, mRNA
NCBI Official Synonym Full Names
RNA polymerase III subunit G like
NCBI Official Symbol
POLR3GL
NCBI Official Synonym Symbols
RPC32HOM; flj32422
NCBI Protein Information
DNA-directed RNA polymerase III subunit RPC7-like
UniProt Protein Name
DNA-directed RNA polymerase III subunit RPC7-like
Protein Family
UniProt Gene Name
POLR3GL
UniProt Synonym Gene Names
RNA polymerase III subunit C7-like
UniProt Entry Name
RPC7L_HUMAN
Uniprot Description
POLR3GL: Belongs to the eukaryotic RPC7 RNA polymerase subunit family.
Protein type: Nucleotide Metabolism - purine; Nucleotide Metabolism - pyrimidine
Chromosomal Location of Human Ortholog: 1q21.1
Cellular Component: cytosol; DNA-directed RNA polymerase III complex; nuclear chromatin; nucleoplasm
Molecular Function: protein binding
Biological Process: positive regulation of interferon type I production; transcription initiation from RNA polymerase III promoter
Similar Products
Product Notes
The POLR3GL polr3gl (Catalog #AAA1271550) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagcc ggggtggggg ccggggtcgt ggccggggcc agttgacctt caacgtggag gccgtgggca ttgggaaagg ggatgctttg cccccaccca ccctgcagcc ttctccactc ttccctccct tggagttccg cccagtacct ttgccctcag gcgaggaagg ggaatatgtc ctggcactga agcaagagct acgaggagcc atgaggcagc tcccctactt catccggcca gctgtcccca agagagatgt ggagcgttat tcagacaaat atcagatgtc aggtccgatt gacaatgcca tcgattggaa ccctgattgg cggcgtctac cccgggagct aaagatccga gtgcggaagc tacagaagga acggattaca attctgctcc ccaagaggcc ccctaagacc acagaagata aggaggaaac aatacagaaa ctagagaccc tggagaagaa ggaagaagaa gtaacttcag aggaggatga ggagaaagaa gaagaagaag agaaggaaga ggaggaagaa gaagagtatg atgaagaaga acatgaagag gaaactgatt acatcatgtc atattttgac aatggagagg actttggtgg tgacagtgat gacaatatgg acgaggctat atactga. It is sometimes possible for the material contained within the vial of "POLR3GL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
