Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

POLR3C cdna clone

POLR3C cDNA Clone

Gene Names
POLR3C; RPC3; RPC62
Synonyms
POLR3C; POLR3C cDNA Clone; POLR3C cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgactcaagcagaaattaagctctgttctttgttgctgcaagagcattttggagagattgtagaaaaaattggagtccatctgataagaaccggcagccagccactaagagtaattgcccatgacacaggaacatcactggatcaggtgaagaaagccctgtgtgtcctcgtccaacataacctggtgagttatcaagtgcacaaacgtggtgtggtggagtatgaagcccagtgcagccgggtattgcgaatgcttagatatccccggtacatctatactaccaaaactctgtacagtgacactggagagctgattgttgaggagcttctgttgaacggcaaactgacaatgtcagctgttgtgaagaaagtggcagaccggctcacagagaccatggaggatggcaagaccatggactatgctgaagtatcaaacacatttgtgcgactggcagacacacactttgtacaacgctgcccttcggtacctaccactgagaattcagaccctgggccaccaccacctgcccccacacttgtcattaatgaaaaggacatgtacctggttcctaaactcagcttgatagggaaaggtaaaaggaggagatcatctgatgaagatgctgctggggagcccaaggccaagagaccaaaatatactacagataacaaggagcccattccagatgatgggatttattggcaggccaaccttgacagattccaccaacacttccgtgaccaagccattgtgagcgcagttgctaacaggatggaccagacaagcagcgagattgtgcgaaccatgctccgaatgagtgagattaccacttcctctagtgctcccttcacccagccattgtcttccaatgagatcttcagatccctacctgttggctataacatctctaagcaagttcttgatcagtatctcactctgctggcagatgatccactagagtttgttggaaagtctggcgacagtggtggaggaatgtatgtcatcaacctccataaggcattagcatccctagccacagccactctggagtccgtcgtacaggagagatttgggtctcgctgtgctagaatattccgtctagttttgcagaagaaacacatagagcagaagcaagtggaagactttgcaatgattcctgcaaaggaggcaaaggatatgctatataagatgctctcagaaaatttcatgtcactccaggaaattcccaaaacaccagaccatgccccatccaggaccttctatttatatactgtgaacatcctgtcagctgcccgaatgttgttgcacaggtgctacaagagcatagccaacttgatagaaaggaggcaatttgaaaccaaagagaataagcgtctactagaaaaatctcagagggtagaagccatcattgcatctatgcaggctactggtgcagaggaagcacagttacaagaaatagaggagatgatcacagctcctgaacgtcagcagctagagaccctgaaacgtaatgtcaacaagttggatgccagtgagatccaggtggacgaaaccatcttcctgctggagtcttacattgagtgcaccatgaagagacagtga
Sequence Length
1605
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,612 Da
NCBI Official Full Name
Homo sapiens polymerase (RNA) III (DNA directed) polypeptide C (62kD), mRNA
NCBI Official Synonym Full Names
RNA polymerase III subunit C
NCBI Official Symbol
POLR3C
NCBI Official Synonym Symbols
RPC3; RPC62
NCBI Protein Information
DNA-directed RNA polymerase III subunit RPC3
UniProt Protein Name
DNA-directed RNA polymerase III subunit RPC3
UniProt Gene Name
POLR3C
UniProt Synonym Gene Names
RNA polymerase III subunit C3; RPC62
UniProt Entry Name
RPC3_HUMAN

Uniprot Description

POLR3C: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Specific core component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. May direct with other members of the subcomplex RNA Pol III binding to the TFIIIB- DNA complex via the interactions between TFIIIB and POLR3F. May be involved either in the recruitment and stabilization of the subcomplex within RNA polymerase III, or in stimulating catalytic functions of other subunits during initiation. Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts, such as Epstein-Barr virus-encoded RNAs (EBERs) induce type I interferon and NF- Kappa-B through the RIG-I pathway. Belongs to the eukaryotic RPC3/POLR3C RNA polymerase subunit family.

Protein type: EC 2.7.7.6; Transcription initiation complex; Nucleotide Metabolism - pyrimidine; Transferase; Nucleotide Metabolism - purine

Chromosomal Location of Human Ortholog: 1q21.1

Cellular Component: cytosol; DNA-directed RNA polymerase III complex; nucleoplasm; nucleus

Molecular Function: DNA-directed RNA polymerase activity; protein binding

Biological Process: positive regulation of innate immune response; positive regulation of interferon type I production; positive regulation of interferon-beta production; regulation of transcription from RNA polymerase III promoter

Research Articles on POLR3C

Similar Products

Product Notes

The POLR3C polr3c (Catalog #AAA1277466) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactcaag cagaaattaa gctctgttct ttgttgctgc aagagcattt tggagagatt gtagaaaaaa ttggagtcca tctgataaga accggcagcc agccactaag agtaattgcc catgacacag gaacatcact ggatcaggtg aagaaagccc tgtgtgtcct cgtccaacat aacctggtga gttatcaagt gcacaaacgt ggtgtggtgg agtatgaagc ccagtgcagc cgggtattgc gaatgcttag atatccccgg tacatctata ctaccaaaac tctgtacagt gacactggag agctgattgt tgaggagctt ctgttgaacg gcaaactgac aatgtcagct gttgtgaaga aagtggcaga ccggctcaca gagaccatgg aggatggcaa gaccatggac tatgctgaag tatcaaacac atttgtgcga ctggcagaca cacactttgt acaacgctgc ccttcggtac ctaccactga gaattcagac cctgggccac caccacctgc ccccacactt gtcattaatg aaaaggacat gtacctggtt cctaaactca gcttgatagg gaaaggtaaa aggaggagat catctgatga agatgctgct ggggagccca aggccaagag accaaaatat actacagata acaaggagcc cattccagat gatgggattt attggcaggc caaccttgac agattccacc aacacttccg tgaccaagcc attgtgagcg cagttgctaa caggatggac cagacaagca gcgagattgt gcgaaccatg ctccgaatga gtgagattac cacttcctct agtgctccct tcacccagcc attgtcttcc aatgagatct tcagatccct acctgttggc tataacatct ctaagcaagt tcttgatcag tatctcactc tgctggcaga tgatccacta gagtttgttg gaaagtctgg cgacagtggt ggaggaatgt atgtcatcaa cctccataag gcattagcat ccctagccac agccactctg gagtccgtcg tacaggagag atttgggtct cgctgtgcta gaatattccg tctagttttg cagaagaaac acatagagca gaagcaagtg gaagactttg caatgattcc tgcaaaggag gcaaaggata tgctatataa gatgctctca gaaaatttca tgtcactcca ggaaattccc aaaacaccag accatgcccc atccaggacc ttctatttat atactgtgaa catcctgtca gctgcccgaa tgttgttgca caggtgctac aagagcatag ccaacttgat agaaaggagg caatttgaaa ccaaagagaa taagcgtcta ctagaaaaat ctcagagggt agaagccatc attgcatcta tgcaggctac tggtgcagag gaagcacagt tacaagaaat agaggagatg atcacagctc ctgaacgtca gcagctagag accctgaaac gtaatgtcaa caagttggat gccagtgaga tccaggtgga cgaaaccatc ttcctgctgg agtcttacat tgagtgcacc atgaagagac agtga. It is sometimes possible for the material contained within the vial of "POLR3C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual