POLR2J cdna clone

POLR2J

Cat. Num. AAA200815

• Gene Names: POLR2J; RPB11; RPB11A; RPB11m; hRPB14; POLR2J1
• Synonyms: POLR2J; hRPB14; POLR2J1; RPB11; RPB11A; RPB11m; POLR2J cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGAACGCCCCTCCAGCCTTCGAGTCGTTCTTGCTCTTCGAGGGCGAGAAGAAGATCACCATTAACAAGGACACCAAGGTACCCAATGCCTGTTTATTCACCATCAACAAAGAAGACCACACACTGGGAAACATCATTAAATCACAACTCCTAAAAGACCCGCAAGTGCTATTTGCTGGCTACAAAGTCCCCCACCCCTTGGAGCACAAGATCATCATCCGAGTGCAGACCACGCCGGACTACAGCCCCCAGGAAGCCTTTACCAACGCCATCACCGACCTCATCAGTGAGCTGTCCCTGCTGGAGGAGCGCTTTCGGGTGGCCATAAAAGACAAGCAGGAAGGAATTGAGTAG; ; Translation Sequence: MNAPPAFESF LLFEGEKKIT INKDTKVPNA CLFTINKEDH TLGNIIKSQL LKDPQVLFAG YKVPHPLEHK IIIRVQTTPD YSPQEAFTNA ITDLISELSL LEERFRVAIK DKQEGIE
• Sequence Length: 117

• Species: Human
• Chromosome Location: 7q22.1
• OMIM Reference Number: 604150
• cDNA Size: 354bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for POLR2J cdna clone

POLR2J encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene exists as a heterodimer with another polymerase subunit; together they form a core subassembly unit of the polymerase. Two similar genes are located nearby on chromosome 7q22. 1 and a pseudogene is found on chromosome 7p13.

Product Categories/Family for POLR2J cdna clone

Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 5453932
• NCBI GeneID: 5439
• NCBI Accession #: NP_006225.1
• NCBI GenBank Nucleotide #: NM_006234.4
• UniProt Accession #: P52435
• NCBI Official Full Name: DNA-directed RNA polymerase II subunit RPB11-a isoform 1
• NCBI Official Synonym Full Names: RNA polymerase II subunit J
• NCBI Official Symbol: POLR2J
• NCBI Official Synonym Symbols: RPB11; RPB11A; RPB11m; hRPB14; POLR2J1
• NCBI Protein Information: DNA-directed RNA polymerase II subunit RPB11-a
• UniProt Protein Name: DNA-directed RNA polymerase II subunit RPB11-a
• Protein Family: DNA-directed RNA polymerase
• UniProt Gene Name: POLR2J
• UniProt Synonym Gene Names: POLR2J1; RNA polymerase II subunit B11-a; RPB11a
• UniProt Entry Name: RPB11_HUMAN

NCBI Description

This gene encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene exists as a heterodimer with another polymerase subunit; together they form a core subassembly unit of the polymerase. Two similar genes are located nearby on chromosome 7q22.1 and a pseudogene is found on chromosome 7p13. [provided by RefSeq, Jul 2008]

Uniprot Description

POLR2J: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Component of RNA polymerase II which synthesizes mRNA precursors and many functional non-coding RNAs. Pol II is the central component of the basal RNA polymerase II transcription machinery. It is composed of mobile elements that move relative to each other. RPB11 is part of the core element with the central large cleft. Belongs to the archaeal RpoL/eukaryotic RPB11/RPC19 RNA polymerase subunit family.

Protein type: RNA splicing; RNA processing; Transferase; DNA-binding

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: nucleoplasm; DNA-directed RNA polymerase II, core complex; nucleus

Molecular Function: protein dimerization activity; protein binding; DNA binding; DNA-directed RNA polymerase activity; LRR domain binding

Biological Process: nuclear mRNA splicing, via spliceosome; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter; mRNA capping; viral reproduction; nucleotide-excision repair; somatic stem cell maintenance; positive regulation of viral transcription; transcription-coupled nucleotide-excision repair; RNA splicing; RNA elongation from RNA polymerase II promoter; gene expression; DNA repair