Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POLR2F cdna clone

POLR2F cDNA Clone

Gene Names
POLR2F; RPB6; POLRF; RPC15; RPABC2; RPB14.4; HRBP14.4; RPABC14.4
Synonyms
POLR2F; POLR2F cDNA Clone; POLR2F cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagacaacgaggacaattttgatggcgacgactttgatgatgtggaggaggatgaagggctagatgacttggagaatgccgaagaggaaggccaggagaatgtcgagatcctcccctctggggagcgaccgcaggccaaccagaagcgaatcaccacaccatacatgaccaagtacgagcgagcccgcgtgctgggcacccgagcgctccagattgcgatgtgtgcccctgtgatggtggagctggagggggagacagatcctctgctcattgccatgaaggaactcaaggcccgaaagatccccatcatcattcgccgttacctgccagatgggagctatgaagactggggggtggacgagctcatcatcaccgactga
Sequence Length
384
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,478 Da
NCBI Official Full Name
Homo sapiens polymerase (RNA) II (DNA directed) polypeptide F, mRNA
NCBI Official Synonym Full Names
RNA polymerase II subunit F
NCBI Official Symbol
POLR2F
NCBI Official Synonym Symbols
RPB6; POLRF; RPC15; RPABC2; RPB14.4; HRBP14.4; RPABC14.4
NCBI Protein Information
DNA-directed RNA polymerases I, II, and III subunit RPABC2
UniProt Protein Name
DNA-directed RNA polymerases I, II, and III subunit RPABC2
UniProt Gene Name
POLR2F
UniProt Synonym Gene Names
POLRF; RNA polymerases I, II, and III subunit ABC2; RPB14.4
UniProt Entry Name
RPAB2_HUMAN

NCBI Description

This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

POLR2F: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common component of RNA polymerases I, II, and III which synthesize ribosomal RNA precursors, mRNA precursors and many functional non-coding RNAs, and small RNAs, such as 5S rRNA and tRNAs, respectively. Pol II is the central component of the basal RNA polymerase II transcription machinery. Pols are composed of mobile elements that move relative to each other. In Pol II, POLR2F/RPB6 is part of the clamp element and togther with parts of RPB1 and RPB2 forms a pocket to which the RPB4-RPB7 subcomplex binds. Belongs to the archaeal RpoK/eukaryotic RPB6 RNA polymerase subunit family.

Protein type: Nucleotide Metabolism - purine; EC 2.7.7.6; Transcription initiation complex; Transferase; Nucleotide Metabolism - pyrimidine; RNA processing

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: cytosol; DNA-directed RNA polymerase I complex; DNA-directed RNA polymerase II, core complex; DNA-directed RNA polymerase III complex; nucleolus; nucleoplasm; nucleus

Biological Process: fibroblast growth factor receptor signaling pathway; gene expression; mRNA capping; nuclear mRNA splicing, via spliceosome; positive regulation of gene expression, epigenetic; positive regulation of interferon type I production; positive regulation of viral transcription; RNA elongation from RNA polymerase I promoter; RNA elongation from RNA polymerase II promoter; RNA-mediated gene silencing; snRNA transcription from RNA polymerase II promoter; somatic stem cell maintenance; termination of RNA polymerase I transcription; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase I promoter; transcription initiation from RNA polymerase II promoter; transcription-coupled nucleotide-excision repair

Research Articles on POLR2F

Similar Products

Product Notes

The POLR2F polr2f (Catalog #AAA1267337) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagaca acgaggacaa ttttgatggc gacgactttg atgatgtgga ggaggatgaa gggctagatg acttggagaa tgccgaagag gaaggccagg agaatgtcga gatcctcccc tctggggagc gaccgcaggc caaccagaag cgaatcacca caccatacat gaccaagtac gagcgagccc gcgtgctggg cacccgagcg ctccagattg cgatgtgtgc ccctgtgatg gtggagctgg agggggagac agatcctctg ctcattgcca tgaaggaact caaggcccga aagatcccca tcatcattcg ccgttacctg ccagatggga gctatgaaga ctggggggtg gacgagctca tcatcaccga ctga. It is sometimes possible for the material contained within the vial of "POLR2F, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.