Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POLR2C cdna clone

POLR2C cDNA Clone

Gene Names
POLR2C; RPB3; RPB31; hRPB33; hsRPB3
Synonyms
POLR2C; POLR2C cDNA Clone; POLR2C cdna clone
Ordering
For Research Use Only!
Sequence
atgccgtacgccaaccagcctaccgtgcggatcacggagctcactgacgagaatgtcaagttcatcatcgagaacaccgacctggcggtggccaattcgattcggagggtcttcatcgctgaggttcccataatagccattgactgggttcagattgatgccaattcctcagttcttcatgatgaattcattgctcacaggcttggattaattcccctcattagtgatgacattgtggacaagctgcagtactctcgggactgcacatgtgaggagttctgccccgagtgctcggtggagttcaccctcgatgtgcggtgcaatgaagaccagacgcgacatgtcacgtctcgagacctcatctccaacagcccccgggtcattccggtgacatcccggaaccgagataatgaccccaatgactacgtggagcaggatgacatcctcatcgtcaagttgagaaagggccaggagctgagacttcgagcctatgccaaaaagggctttggcaaggagcatgccaagtggaaccctactgcaggggtggcttttgaatacgatccagacaatgccctgaggcacacagtgtaccccaagcccgaggaatggccaaagagtgagtactcggagctggatgaggatgagtcgcaggctccctatgaccccaacggcaagccagaaaggttttactacaatgtggagtcctgtggctctctgcgtcctgaaaccattgtcctgtcagccctctcaggattgaagaagaaactgagtgatttacaaactcaattaagccacgagatccagagtgatgtgctaaccataaattaa
Sequence Length
828
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,441 Da
NCBI Official Full Name
Homo sapiens polymerase (RNA) II (DNA directed) polypeptide C, 33kDa, mRNA
NCBI Official Synonym Full Names
RNA polymerase II subunit C
NCBI Official Symbol
POLR2C
NCBI Official Synonym Symbols
RPB3; RPB31; hRPB33; hsRPB3
NCBI Protein Information
DNA-directed RNA polymerase II subunit RPB3
UniProt Protein Name
DNA-directed RNA polymerase II subunit RPB3
UniProt Gene Name
POLR2C
UniProt Synonym Gene Names
RNA polymerase II subunit 3; RNA polymerase II subunit B3; RPB33
UniProt Entry Name
RPB3_HUMAN

NCBI Description

This gene encodes the third largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a cysteine rich region and exists as a heterodimer with another polymerase subunit, POLR2J. These two subunits form a core subassembly unit of the polymerase. A pseudogene has been identified on chromosome 21. [provided by RefSeq, Jul 2008]

Uniprot Description

POLR2C: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Component of RNA polymerase II which synthesizes mRNA precursors and many functional non-coding RNAs. Pol II is the central component of the basal RNA polymerase II transcription machinery. It is composed of mobile elements that move relative to each other. RPB3 is part of the core element with the central large cleft and the clamp element that moves to open and close the cleft. Belongs to the archaeal RpoD/eukaryotic RPB3 RNA polymerase subunit family.

Protein type: DNA-binding; Nucleotide Metabolism - pyrimidine; Nucleotide Metabolism - purine; Transcription initiation complex

Chromosomal Location of Human Ortholog: 16q13-q21

Cellular Component: cytoplasm; DNA-directed RNA polymerase II, core complex; microtubule cytoskeleton; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: fibroblast growth factor receptor signaling pathway; gene expression; mRNA capping; nuclear mRNA splicing, via spliceosome; positive regulation of viral transcription; RNA elongation from RNA polymerase II promoter; RNA-mediated gene silencing; snRNA transcription from RNA polymerase II promoter; somatic stem cell maintenance; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter; transcription-coupled nucleotide-excision repair

Research Articles on POLR2C

Similar Products

Product Notes

The POLR2C polr2c (Catalog #AAA1269787) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgtacg ccaaccagcc taccgtgcgg atcacggagc tcactgacga gaatgtcaag ttcatcatcg agaacaccga cctggcggtg gccaattcga ttcggagggt cttcatcgct gaggttccca taatagccat tgactgggtt cagattgatg ccaattcctc agttcttcat gatgaattca ttgctcacag gcttggatta attcccctca ttagtgatga cattgtggac aagctgcagt actctcggga ctgcacatgt gaggagttct gccccgagtg ctcggtggag ttcaccctcg atgtgcggtg caatgaagac cagacgcgac atgtcacgtc tcgagacctc atctccaaca gcccccgggt cattccggtg acatcccgga accgagataa tgaccccaat gactacgtgg agcaggatga catcctcatc gtcaagttga gaaagggcca ggagctgaga cttcgagcct atgccaaaaa gggctttggc aaggagcatg ccaagtggaa ccctactgca ggggtggctt ttgaatacga tccagacaat gccctgaggc acacagtgta ccccaagccc gaggaatggc caaagagtga gtactcggag ctggatgagg atgagtcgca ggctccctat gaccccaacg gcaagccaga aaggttttac tacaatgtgg agtcctgtgg ctctctgcgt cctgaaacca ttgtcctgtc agccctctca ggattgaaga agaaactgag tgatttacaa actcaattaa gccacgagat ccagagtgat gtgctaacca taaattaa. It is sometimes possible for the material contained within the vial of "POLR2C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.