POLDIP2 cdna clone
POLDIP2 cDNA Clone
Gene Names
POLDIP2; p38; POLD4; PDIP38
Synonyms
POLDIP2; POLDIP2 cDNA Clone; POLDIP2 cdna clone
Sequence
atggcagcctgtacagcccggcgggccctggccgtgggcagccgctggtggtcccggtcgctgactggggcccggtggccaaggccgctctgtgcggcggccggagctggagccttctcgccagcgtcgaccacgacgacgcggaggcacctctcgtcccgaaaccgaccagagggcaaagtgttggagacagttggtgtgtttgaggtgccaaaacagaatggaaaatatgagaccgggcagcttttccttcatagcatttttggctaccgaggtgtcgtcctgtttccctggcaggccagactgtatgaccgggatgtggcttctgcagctccagaaaaagcagagaaccctgctggccatggctccaaggaggtgaaaggcaaaactcacacttactatcaggtgctgattgatgctcgtgactgcccacatatatctcagagatctcagacagaagctgtgaccttcttggctaaccatgatgacagtcgggccctctatgccatcccaggcttggactatgtcagccatgaagacatcctcccctacacctccactgatcaggttcccatccaacatgaactctttgaaagatttcttctgtatgaccagacaaaagcacctccttttgtggctcgggagacgctaagggcctggcaagagaagaatcacccctggctggagctctccgatgttcatcgggaaacaactgagaacatacgtgtcactgtcatccccttctacatgggcatgagggaagcccagaattcccacgtgtactggtggcgctactgtatccgtttggagaaccttgacagtgatgtggtacagctccgggagcggcactggaggatattcagtctctctggcaccttggagacagtgcgaggccgaggggtagtgggcagggaaccagtgttatccaaggagcagcctgcgttccagtatagcagccacgtctcgctgcaggcttccagtgggcacatgtggggcacgttccgctttgaaagacctgatggctcccactttgatgttcggattcctcccttctccctggaaagcaataaagatgagaagacaccaccctcaggccttcactggtag
Sequence Length
1107
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,033 Da
NCBI Official Full Name
Homo sapiens polymerase (DNA-directed), delta interacting protein 2, mRNA
NCBI Official Synonym Full Names
DNA polymerase delta interacting protein 2
NCBI Official Symbol
POLDIP2
NCBI Official Synonym Symbols
p38; POLD4; PDIP38
NCBI Protein Information
polymerase delta-interacting protein 2
UniProt Protein Name
Polymerase delta-interacting protein 2
Protein Family
UniProt Gene Name
POLDIP2
UniProt Synonym Gene Names
PDIP38; POLD4; p38
UniProt Entry Name
PDIP2_HUMAN
NCBI Description
This gene encodes a protein that interacts with the DNA polymerase delta p50 subunit, as well as with proliferating cell nuclear antigen. The encoded protein maybe play a role in the ability of the replication fork to bypass DNA lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Uniprot Description
POLDIP2: Interacts with PCNA and POLD2.
Chromosomal Location of Human Ortholog: 17q11.2
Cellular Component: mitochondrion
Molecular Function: protein binding
Research Articles on POLDIP2
Similar Products
Product Notes
The POLDIP2 poldip2 (Catalog #AAA1269969) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcct gtacagcccg gcgggccctg gccgtgggca gccgctggtg gtcccggtcg ctgactgggg cccggtggcc aaggccgctc tgtgcggcgg ccggagctgg agccttctcg ccagcgtcga ccacgacgac gcggaggcac ctctcgtccc gaaaccgacc agagggcaaa gtgttggaga cagttggtgt gtttgaggtg ccaaaacaga atggaaaata tgagaccggg cagcttttcc ttcatagcat ttttggctac cgaggtgtcg tcctgtttcc ctggcaggcc agactgtatg accgggatgt ggcttctgca gctccagaaa aagcagagaa ccctgctggc catggctcca aggaggtgaa aggcaaaact cacacttact atcaggtgct gattgatgct cgtgactgcc cacatatatc tcagagatct cagacagaag ctgtgacctt cttggctaac catgatgaca gtcgggccct ctatgccatc ccaggcttgg actatgtcag ccatgaagac atcctcccct acacctccac tgatcaggtt cccatccaac atgaactctt tgaaagattt cttctgtatg accagacaaa agcacctcct tttgtggctc gggagacgct aagggcctgg caagagaaga atcacccctg gctggagctc tccgatgttc atcgggaaac aactgagaac atacgtgtca ctgtcatccc cttctacatg ggcatgaggg aagcccagaa ttcccacgtg tactggtggc gctactgtat ccgtttggag aaccttgaca gtgatgtggt acagctccgg gagcggcact ggaggatatt cagtctctct ggcaccttgg agacagtgcg aggccgaggg gtagtgggca gggaaccagt gttatccaag gagcagcctg cgttccagta tagcagccac gtctcgctgc aggcttccag tgggcacatg tggggcacgt tccgctttga aagacctgat ggctcccact ttgatgttcg gattcctccc ttctccctgg aaagcaataa agatgagaag acaccaccct caggccttca ctggtag. It is sometimes possible for the material contained within the vial of "POLDIP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
