Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POFUT1 cdna clone

POFUT1 cDNA Clone

Gene Names
POFUT1; DDD2; FUT12; O-FUT; OFUCT1; O-Fuc-T; O-FucT-1
Synonyms
POFUT1; POFUT1 cDNA Clone; POFUT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcgccgccgcgtgggcacggccgctgagcgtgtctttcctgctgctgcttctgccgctcccggggatgcctgcgggctcctgggacccggccggttacctgctctactgcccctgcatggggcgctttgggaaccaggccgatcacttcttgggctctctggcatttgcaaagctgctaaaccgtaccttggctgtccctccttggattgagtaccagcatcacaagcctcctttcaccaacctccatgtgtcctaccagaagtacttcaagctggagcccctccaggcttaccatcgggtcatcagcttggaggatttcatggagaagctggcacccacccactggccccctgagaagcgggtggcatactgctttgaggtggcagcccagcgaagcccagataagaagacgtgccccatgaaggaaggaaacccctttggcccattctgggatcagtttcatgtgagtttcaacaagtcggagctttttacaggcatttccttcagtgcttcctacagagaacaatggagccagaggcgtgagaatcactcctgtgttaccttactcttcccaaggtga
Sequence Length
585
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,338 Da
NCBI Official Full Name
Homo sapiens protein O-fucosyltransferase 1, mRNA
NCBI Official Synonym Full Names
protein O-fucosyltransferase 1
NCBI Official Symbol
POFUT1
NCBI Official Synonym Symbols
DDD2; FUT12; O-FUT; OFUCT1; O-Fuc-T; O-FucT-1
NCBI Protein Information
GDP-fucose protein O-fucosyltransferase 1
UniProt Protein Name
GDP-fucose protein O-fucosyltransferase 1
UniProt Gene Name
POFUT1
UniProt Synonym Gene Names
FUT12; KIAA0180; O-FucT-1
UniProt Entry Name
OFUT1_HUMAN

NCBI Description

This gene encodes a member of the glycosyltransferase O-Fuc family. This enzyme adds O-fucose through an O-glycosidic linkage to conserved serine or threonine residues in the epidermal growth factor-like repeats of a number of cell surface and secreted proteins. O-fucose glycans are involved in ligand-induced receptor signaling. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

POFUT1: Catalyzes the reaction that attaches fucose through an O-glycosidic linkage to a conserved serine or threonine residue in EGF domains. Plays a crucial role in Notch signaling. Belongs to the glycosyltransferase 68 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; EC 2.4.1.221

Chromosomal Location of Human Ortholog: 20q11

Cellular Component: endoplasmic reticulum; membrane

Molecular Function: fucosyltransferase activity; peptide-O-fucosyltransferase activity

Biological Process: O-glycan processing; protein amino acid O-linked glycosylation

Disease: Dowling-degos Disease 2

Research Articles on POFUT1

Similar Products

Product Notes

The POFUT1 pofut1 (Catalog #AAA1273933) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcgccg ccgcgtgggc acggccgctg agcgtgtctt tcctgctgct gcttctgccg ctcccgggga tgcctgcggg ctcctgggac ccggccggtt acctgctcta ctgcccctgc atggggcgct ttgggaacca ggccgatcac ttcttgggct ctctggcatt tgcaaagctg ctaaaccgta ccttggctgt ccctccttgg attgagtacc agcatcacaa gcctcctttc accaacctcc atgtgtccta ccagaagtac ttcaagctgg agcccctcca ggcttaccat cgggtcatca gcttggagga tttcatggag aagctggcac ccacccactg gccccctgag aagcgggtgg catactgctt tgaggtggca gcccagcgaa gcccagataa gaagacgtgc cccatgaagg aaggaaaccc ctttggccca ttctgggatc agtttcatgt gagtttcaac aagtcggagc tttttacagg catttccttc agtgcttcct acagagaaca atggagccag aggcgtgaga atcactcctg tgttacctta ctcttcccaa ggtga. It is sometimes possible for the material contained within the vial of "POFUT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.