Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PNPLA2 cdna clone

PNPLA2 cDNA Clone

Gene Names
PNPLA2; ATGL; TTS2; PEDF-R; FP17548; TTS-2.2; iPLA2zeta; 1110001C14Rik
Synonyms
PNPLA2; PNPLA2 cDNA Clone; PNPLA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttccccgcgagaagacgtggaacatctcgttcgcgggctgcggcttcctcggcgtctactacgtcggcgtggcctcctgcctccgcgagcacgcgcccttcctggtggccaacgccacgcacatctacggcgcctcggccggggcgctcacggccacggcgctggtcaccggggtctgcctgggtgaggctggtgccaagttcattgaggtatctaaagaggcccggaagcggttcctgggccccctgcacccctccttcaacctggtaaagatcatccgcagtttcctgctgaaggtcctgcctgctgatagccatgagcatgccagtgggcgcctgggcatctccctgacccgcgtgtcagacggcgagaatgtcattatatcccacttcaactccaaggacgagctcatccaggccaatgtctgcagcggtttcatccccgtgtactgtgggctcatccctccctccctccagggggtgcgctacgtggatggtggcatttcagacaacctgccactctatgagcttaagaacaccatcacagtgtcccccttctcgggcgagagtgacatctgtccgcaggacagctccaccaacatccacgagctgcgggtcaccaacaccagcatccagttcaacctgcgcaacctctaccgcctctccaaggccctcttcccgccggagcccctggtgctgcgagagatgtgcaagcagggataccgggatggcctgcgctttctgcagcggaacggcctcctgaaccggcccaaccccttgctggcgttgccccccgcccgcccccacggcccagaggacaaggaccaggcagtggagagcgcccaagcggaggattactcgcagctgccgggagaagatcacatcctggagcacctgcccgcccggctcaatgaggccctgctggaggcctgcgtggagcccacggacctgctgaccaccctctccaacatgctgcctgtgcgtctggccacggccatgatggtgccctacacgctgccgctggagagcgctctgtccttcaccatccgcttgctggagtggctgcccgacgttcccgaggacatccggtggatgaaggagcagacgggcagcatctgccagtacctggtgatgcgcgccaagaggaagctgggcaggcacctgccctccaggctgccggagcaggtggagctgcgccgcgtccagtcgctgccgtccgtgccgctgtcctgcgccgcctacagagaggcactgcccggctggatgcgcaacaacctctcgctgggggacgcgctggccaagtgggaggagtgccagcgccagctgctgctcggcctcttctgcaccaacgtggccttcccgcccgaagctctgcgcatgcgcgcacccgccgacccggctcccgcccccgcggacccagcatccccgcagcaccagctggccgggcctgcccccttgctgagcacccctgctcccgaggcccggcccgtgatcggggccctggggctgtga
Sequence Length
1515
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,875 Da
NCBI Official Full Name
Homo sapiens patatin-like phospholipase domain containing 2, mRNA
NCBI Official Synonym Full Names
patatin like phospholipase domain containing 2
NCBI Official Symbol
PNPLA2
NCBI Official Synonym Symbols
ATGL; TTS2; PEDF-R; FP17548; TTS-2.2; iPLA2zeta; 1110001C14Rik
NCBI Protein Information
patatin-like phospholipase domain-containing protein 2
UniProt Protein Name
Patatin-like phospholipase domain-containing protein 2
UniProt Gene Name
PNPLA2
UniProt Synonym Gene Names
ATGL; TTS2
UniProt Entry Name
PLPL2_HUMAN

NCBI Description

This gene encodes an enzyme which catalyzes the first step in the hydrolysis of triglycerides in adipose tissue. Mutations in this gene are associated with neutral lipid storage disease with myopathy. [provided by RefSeq, Jul 2010]

Uniprot Description

PNPLA2: the rate-limiting lipolytic enzyme in mammals, flies, and yeast. Catalyzes the initial step in triglyceride hydrolysis in adipocyte and non-adipocyte lipid droplets. Upregulated by exercise training in human skeletal muscle. Has acylglycerol transacylase activity. May act coordinately with HSL within the lipolytic cascade. Regulates adiposome size and may be involved in the degradation of adiposomes. May play an important role in energy homeostasis. May play a role in the response of the organism to starvation, enhancing hydrolysis of triglycerides and providing free fatty acids to other tissues to be oxidized in situations of energy depletion. Interacting with ABHD5 stimulates its triglyceride hydrolase activity. Despite a colocalization in lipid droplets, it probably does not interact with perilipin. Transcriptionally regulated by FOXO1A. Defects cause neutral lipid storage disease (NLSD), an autosomal recessive disorder characterized by the excessive accumulation of neutral lipids in multiple tissues. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipase; EC 3.1.1.3; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11p15.5

Cellular Component: cytoplasm; endoplasmic reticulum membrane; lipid particle; membrane

Molecular Function: acylglycerol O-acyltransferase activity; lipoprotein lipase activity; triacylglycerol lipase activity

Biological Process: lipid homeostasis

Disease: Neutral Lipid Storage Disease With Myopathy

Research Articles on PNPLA2

Similar Products

Product Notes

The PNPLA2 pnpla2 (Catalog #AAA1274626) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttcccc gcgagaagac gtggaacatc tcgttcgcgg gctgcggctt cctcggcgtc tactacgtcg gcgtggcctc ctgcctccgc gagcacgcgc ccttcctggt ggccaacgcc acgcacatct acggcgcctc ggccggggcg ctcacggcca cggcgctggt caccggggtc tgcctgggtg aggctggtgc caagttcatt gaggtatcta aagaggcccg gaagcggttc ctgggccccc tgcacccctc cttcaacctg gtaaagatca tccgcagttt cctgctgaag gtcctgcctg ctgatagcca tgagcatgcc agtgggcgcc tgggcatctc cctgacccgc gtgtcagacg gcgagaatgt cattatatcc cacttcaact ccaaggacga gctcatccag gccaatgtct gcagcggttt catccccgtg tactgtgggc tcatccctcc ctccctccag ggggtgcgct acgtggatgg tggcatttca gacaacctgc cactctatga gcttaagaac accatcacag tgtccccctt ctcgggcgag agtgacatct gtccgcagga cagctccacc aacatccacg agctgcgggt caccaacacc agcatccagt tcaacctgcg caacctctac cgcctctcca aggccctctt cccgccggag cccctggtgc tgcgagagat gtgcaagcag ggataccggg atggcctgcg ctttctgcag cggaacggcc tcctgaaccg gcccaacccc ttgctggcgt tgccccccgc ccgcccccac ggcccagagg acaaggacca ggcagtggag agcgcccaag cggaggatta ctcgcagctg ccgggagaag atcacatcct ggagcacctg cccgcccggc tcaatgaggc cctgctggag gcctgcgtgg agcccacgga cctgctgacc accctctcca acatgctgcc tgtgcgtctg gccacggcca tgatggtgcc ctacacgctg ccgctggaga gcgctctgtc cttcaccatc cgcttgctgg agtggctgcc cgacgttccc gaggacatcc ggtggatgaa ggagcagacg ggcagcatct gccagtacct ggtgatgcgc gccaagagga agctgggcag gcacctgccc tccaggctgc cggagcaggt ggagctgcgc cgcgtccagt cgctgccgtc cgtgccgctg tcctgcgccg cctacagaga ggcactgccc ggctggatgc gcaacaacct ctcgctgggg gacgcgctgg ccaagtggga ggagtgccag cgccagctgc tgctcggcct cttctgcacc aacgtggcct tcccgcccga agctctgcgc atgcgcgcac ccgccgaccc ggctcccgcc cccgcggacc cagcatcccc gcagcaccag ctggccgggc ctgccccctt gctgagcacc cctgctcccg aggcccggcc cgtgatcggg gccctggggc tgtga. It is sometimes possible for the material contained within the vial of "PNPLA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.