PNLIPRP3 cdna clone

PNLIPRP3 cDNA Clone

Synonyms

PNLIPRP3; PNLIPRP3 cDNA Clone; PNLIPRP3 cdna clone

Ordering
Cat. Num. AAA1267454 When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures. For Research Use Only!

Sequence

atgcttggaatttggattgttgcattcttgttctttggcacatcaagaggaaaagaagtttgctatgaaaggttagggtgtttcaaagatggtttaccatggaccaggactttctcaacagagttggtaggtttaccctggtctccagagaagataaacactcgtttcctgctctacactatacacaatcccaatgcctatcaggagatcagtgcggttaattcttcaactatccaagcctcatattttggaacagacaagatcacccgtatcaacatagctggatggaaaacagatggcaaatggcagagagacatgtgcaatgtgttgctacagctggaagatataaattgcattaatttagattggatcaacggttcacgggaatacatccatgctgtaaacaatctccgtgttgttggtgctgaggtggcttattttattgatgttctcatgaaaaaatttgaatattccccttctaaagtgcacttgattggccacagcttgggagcacacctggctggggaagctgggtcaaggataccaggccttggaagaataactgggttggacccagctgggccatttttccacaacactccaaaggaagtcaggctagacccctcggatgccaactttgttgacgttattcatacaaatgcagctcgcatcctctttgagcttggtgttggaaccattgatgcttgtggtcatcttgacttttacccaaatggagggaagcacatgccaggatgtgaagacttaattacacctttactgaaatttaacttcaatgcttacaaaaaagaaatggcttccttctttgactgtaaccatgcccgaagttatcaattttatgctgaaagcattcttaatcctgatgcatttattgcttatccttgtagatcctacacatcttttaaagcaggaaattgcttcttttgttccaaagaaggttgcccaacaatgggtcattttgctgatagatttcacttcaaaaatatgaagactaatggatcacattattttttaaacacagggtccctttccccatttgcccgttggaggcacaaattgtctgttaaactcagtggaagcgaagtcactcaaggaactgtctttcttcgtgtaggcggggcaattgggaaaactggggagtttgccattgtcagtggaaaacttgagccaggcatgacttacacaaaattaatcgatgcagatgttaacgttggaaacattacaagtgttcagttcatctggaaaaaacatttgtttgaagattctcagaataagttgggagcagaaatggtgataaatacatctgggaaatatggatataaatctaccttctgtagccaagacattatgggacctaatattctccagaacctgaaaccatgctaa

Sequence Length

1404

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

109658989

NCBI GeneID

119548

Molecular Weight

52,254 Da

NCBI Official Full Name

Homo sapiens pancreatic lipase-related protein 3, mRNA

NCBI Official Synonym Full Names

pancreatic lipase related protein 3

NCBI Official Symbol

PNLIPRP3

NCBI Protein Information

pancreatic lipase-related protein 3

UniProt Protein Name

Pancreatic lipase-related protein 3

Protein Family

Pancreatic lipase-related protein

UniProt Gene Name

PNLIPRP3

UniProt Synonym Gene Names

PL-RP3

UniProt Entry Name

LIPR3_HUMAN

Uniprot Description

PNLIPRP3: Belongs to the AB hydrolase superfamily. Lipase family.

Protein type: EC 3.1.1.3; Secreted; Secreted, signal peptide; Hydrolase

Chromosomal Location of Human Ortholog: 10q25.3

Research Articles on PNLIPRP3

1. Over expression of pancreatic lipase-related protein 3 is associated with hepatocellular carcinoma.

Similar Products

Product Notes

The PNLIPRP3 pnliprp3 (Catalog #AAA1267454) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttggaa tttggattgt tgcattcttg ttctttggca catcaagagg aaaagaagtt tgctatgaaa ggttagggtg tttcaaagat ggtttaccat ggaccaggac tttctcaaca gagttggtag gtttaccctg gtctccagag aagataaaca ctcgtttcct gctctacact atacacaatc ccaatgccta tcaggagatc agtgcggtta attcttcaac tatccaagcc tcatattttg gaacagacaa gatcacccgt atcaacatag ctggatggaa aacagatggc aaatggcaga gagacatgtg caatgtgttg ctacagctgg aagatataaa ttgcattaat ttagattgga tcaacggttc acgggaatac atccatgctg taaacaatct ccgtgttgtt ggtgctgagg tggcttattt tattgatgtt ctcatgaaaa aatttgaata ttccccttct aaagtgcact tgattggcca cagcttggga gcacacctgg ctggggaagc tgggtcaagg ataccaggcc ttggaagaat aactgggttg gacccagctg ggccattttt ccacaacact ccaaaggaag tcaggctaga cccctcggat gccaactttg ttgacgttat tcatacaaat gcagctcgca tcctctttga gcttggtgtt ggaaccattg atgcttgtgg tcatcttgac ttttacccaa atggagggaa gcacatgcca ggatgtgaag acttaattac acctttactg aaatttaact tcaatgctta caaaaaagaa atggcttcct tctttgactg taaccatgcc cgaagttatc aattttatgc tgaaagcatt cttaatcctg atgcatttat tgcttatcct tgtagatcct acacatcttt taaagcagga aattgcttct tttgttccaa agaaggttgc ccaacaatgg gtcattttgc tgatagattt cacttcaaaa atatgaagac taatggatca cattattttt taaacacagg gtccctttcc ccatttgccc gttggaggca caaattgtct gttaaactca gtggaagcga agtcactcaa ggaactgtct ttcttcgtgt aggcggggca attgggaaaa ctggggagtt tgccattgtc agtggaaaac ttgagccagg catgacttac acaaaattaa tcgatgcaga tgttaacgtt ggaaacatta caagtgttca gttcatctgg aaaaaacatt tgtttgaaga ttctcagaat aagttgggag cagaaatggt gataaataca tctgggaaat atggatataa atctaccttc tgtagccaag acattatggg acctaatatt ctccagaacc tgaaaccatg ctaa. It is sometimes possible for the material contained within the vial of "PNLIPRP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

PNLIPRP3 cdna clone