PNLIPRP1 cdna clone
PNLIPRP1 cDNA Clone
Gene Names
PNLIPRP1; PLRP1
Synonyms
PNLIPRP1; PNLIPRP1 cDNA Clone; PNLIPRP1 cdna clone
Sequence
atgctgatcttctggacaatcacacttttcctgctgggagcagccaaaggaaaagaagtttgctatgaggacctcgggtgcttttctgacactgagccctggggcgggacagcaatcaggcccctgaaaattctcccctggagccctgagaagatcggcacccgcttcctgctgtacaccaatgaaaacccaaacaactttcaaattctcctcctctctgatccatcaacaattgaggcatcaaattttcaaatggacagaaagacccggttcatcatccatggcttcatagacaaaggagatgagagctgggtgacagacatgtgcaaggtaggagccagctctgatccctgtggccagctgaggccaacacttctgctaacatctctgcatcactttatgcactcaagaaatctttacatattaggtaactttatgcaattaaaatgcttctcttcacaaaaattaaaatgcctttccatgtttccgcactacatttgcacactgaagcaaccacatttgctgttagaaaagtactcctactacctaatttctggttaa
Sequence Length
561
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
13,245 Da
NCBI Official Full Name
Homo sapiens pancreatic lipase-related protein 1, mRNA
NCBI Official Synonym Full Names
pancreatic lipase related protein 1
NCBI Official Symbol
PNLIPRP1
NCBI Official Synonym Symbols
PLRP1
NCBI Protein Information
inactive pancreatic lipase-related protein 1
UniProt Protein Name
Inactive pancreatic lipase-related protein 1
Protein Family
UniProt Gene Name
PNLIPRP1
UniProt Synonym Gene Names
PLRP1; PL-RP1
UniProt Entry Name
LIPR1_HUMAN
Uniprot Description
PNLIPRP1: May function as inhibitor of dietary triglyceride digestion. Lacks detectable lipase activity towards triglycerides, diglycerides, phosphatidylcholine, galactolipids or cholesterol esters (in vitro). Belongs to the AB hydrolase superfamily. Lipase family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 3.1.1.3; Lipase; Secreted; Secreted, signal peptide; Lipid Metabolism - glycerolipid
Chromosomal Location of Human Ortholog: 10q25.3
Cellular Component: extracellular region; extracellular space
Molecular Function: calcium ion binding; lipase activity; triacylglycerol lipase activity
Research Articles on PNLIPRP1
Similar Products
Product Notes
The PNLIPRP1 pnliprp1 (Catalog #AAA1268528) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgatct tctggacaat cacacttttc ctgctgggag cagccaaagg aaaagaagtt tgctatgagg acctcgggtg cttttctgac actgagccct ggggcgggac agcaatcagg cccctgaaaa ttctcccctg gagccctgag aagatcggca cccgcttcct gctgtacacc aatgaaaacc caaacaactt tcaaattctc ctcctctctg atccatcaac aattgaggca tcaaattttc aaatggacag aaagacccgg ttcatcatcc atggcttcat agacaaagga gatgagagct gggtgacaga catgtgcaag gtaggagcca gctctgatcc ctgtggccag ctgaggccaa cacttctgct aacatctctg catcacttta tgcactcaag aaatctttac atattaggta actttatgca attaaaatgc ttctcttcac aaaaattaaa atgcctttcc atgtttccgc actacatttg cacactgaag caaccacatt tgctgttaga aaagtactcc tactacctaa tttctggtta a. It is sometimes possible for the material contained within the vial of "PNLIPRP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
