Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PNLIP cdna clone

PNLIP cDNA Clone

Gene Names
PNLIP; PL; PTL; PNLIPD
Synonyms
PNLIP; PNLIP cDNA Clone; PNLIP cdna clone
Ordering
For Research Use Only!
Sequence
atgctgccactttggactctttcactgctgctgggagcagtagcaggaaaagaagtttgctacgaaagactcggctgcttcagtgatgactccccatggtcaggaattacggaaagacccctccatatattgccttggtctccaaaagatgtcaacacccgcttcctcctatatactaatgagaacccaaacaactttcaagaagttgccgcagattcatcaagcatcagtggctccaatttcaaaacaaatagaaaaactcgctttattattcatggattcatagacaagggagaagaaaactggctggccaatgtgtgcaagaatctgttcaaggtggaaagtgtgaactgtatctgtgtggactggaaaggtggctcccgaactggatacacacaagcctcgcagaacatcaggatcgtgggagcagaagtggcatattttgttgaatttcttcagtcggcgttcggttactcaccttccaacgtgcatgtcattggccacagcctgggtgcccacgctgctggggaggctggaaggagaaccaatgggaccattggacgcatcacagggttggacccagcagaaccttgctttcagggcacacctgaattagtccgattggaccccagcgatgccaaatttgtggatgtaattcacacggatggtgcccccatagtccccaatttggggtttggaatgagccaagtcgtgggccacctagatttctttccaaatggaggagtggaaatgcctggatgtaaaaagaacattctctctcagattgtggacatagacggaatctgggaagggactcgagactttgcggcctgtaatcacttaagaagctacaaatattacactgatagcatcgtcaaccctgatggctttgctggattcccctgtgcctcttacaacgtcttcactgcaaacaagtgtttcccttgtccaagtggaggctgcccacagatgggtcactatgctgatagatatcctgggaaaacaaatgatgtgggccagaaattttatctagacactggtgatgccagtaattttgcacgttggaggtataaggtatctgtcacactgtctggaaaaaaggttacaggacacatactagtttctttgttcggaaataaaggaaactctaagcagtatgaaattttcaagggcactctcaaaccagatagtactcattccaatgaatttgactcagatgtggatgttggggacttgcagatggttaaatttatttggtataacaatgtgatcaacccaactttacctagagtgggagcatccaagattatagtggagacaaatgttggaaaacagttcaacttctgtagtccagaaaccgtcagggaggaagttctgctcaccctcacaccgtgttag
Sequence Length
1398
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,157 Da
NCBI Official Full Name
Homo sapiens pancreatic lipase, mRNA
NCBI Official Synonym Full Names
pancreatic lipase
NCBI Official Symbol
PNLIP
NCBI Official Synonym Symbols
PL; PTL; PNLIPD
NCBI Protein Information
pancreatic triacylglycerol lipase
UniProt Protein Name
Pancreatic triacylglycerol lipase
UniProt Gene Name
PNLIP
UniProt Synonym Gene Names
PL; PTL; Pancreatic lipase
UniProt Entry Name
LIPP_HUMAN

NCBI Description

This gene encodes a member of the lipase family of proteins. The encoded enzyme is secreted by the pancreas and hydrolyzes triglycerides in the small intestine, and is essential for the efficient digestion of dietary fats. Inhibition of the encoded enzyme may prevent high-fat diet-induced obesity in mice and result in weight loss in human patients with obesity. Mutations in this gene cause congenital pancreatic lipase deficiency, a rare disorder characterized by steatorrhea. [provided by RefSeq, Jul 2016]

Uniprot Description

PNLIP: a member of the lipase gene family. It encodes a carboxyl esterase that hydrolyzes insoluble, emulsified triglycerides, and is essential for the efficient digestion of dietary fats. expressed specifically in the pancreas. [provided by RefSeq, Jul 2008]

Protein type: Hydrolase; EC 3.1.1.3; Lipid Metabolism - glycerolipid; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 10q26.1

Cellular Component: extracellular region

Molecular Function: triacylglycerol lipase activity

Biological Process: lipid digestion; retinoid metabolic process

Disease: Pancreatic Lipase Deficiency

Research Articles on PNLIP

Similar Products

Product Notes

The PNLIP pnlip (Catalog #AAA1274509) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgccac tttggactct ttcactgctg ctgggagcag tagcaggaaa agaagtttgc tacgaaagac tcggctgctt cagtgatgac tccccatggt caggaattac ggaaagaccc ctccatatat tgccttggtc tccaaaagat gtcaacaccc gcttcctcct atatactaat gagaacccaa acaactttca agaagttgcc gcagattcat caagcatcag tggctccaat ttcaaaacaa atagaaaaac tcgctttatt attcatggat tcatagacaa gggagaagaa aactggctgg ccaatgtgtg caagaatctg ttcaaggtgg aaagtgtgaa ctgtatctgt gtggactgga aaggtggctc ccgaactgga tacacacaag cctcgcagaa catcaggatc gtgggagcag aagtggcata ttttgttgaa tttcttcagt cggcgttcgg ttactcacct tccaacgtgc atgtcattgg ccacagcctg ggtgcccacg ctgctgggga ggctggaagg agaaccaatg ggaccattgg acgcatcaca gggttggacc cagcagaacc ttgctttcag ggcacacctg aattagtccg attggacccc agcgatgcca aatttgtgga tgtaattcac acggatggtg cccccatagt ccccaatttg gggtttggaa tgagccaagt cgtgggccac ctagatttct ttccaaatgg aggagtggaa atgcctggat gtaaaaagaa cattctctct cagattgtgg acatagacgg aatctgggaa gggactcgag actttgcggc ctgtaatcac ttaagaagct acaaatatta cactgatagc atcgtcaacc ctgatggctt tgctggattc ccctgtgcct cttacaacgt cttcactgca aacaagtgtt tcccttgtcc aagtggaggc tgcccacaga tgggtcacta tgctgataga tatcctggga aaacaaatga tgtgggccag aaattttatc tagacactgg tgatgccagt aattttgcac gttggaggta taaggtatct gtcacactgt ctggaaaaaa ggttacagga cacatactag tttctttgtt cggaaataaa ggaaactcta agcagtatga aattttcaag ggcactctca aaccagatag tactcattcc aatgaatttg actcagatgt ggatgttggg gacttgcaga tggttaaatt tatttggtat aacaatgtga tcaacccaac tttacctaga gtgggagcat ccaagattat agtggagaca aatgttggaa aacagttcaa cttctgtagt ccagaaaccg tcagggagga agttctgctc accctcacac cgtgttag. It is sometimes possible for the material contained within the vial of "PNLIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.