Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PNCK cdna clone

PNCK cDNA Clone

Gene Names
PNCK; BSTK3; CaMK1b
Synonyms
PNCK; PNCK cDNA Clone; PNCK cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctgctgaagaaacacacggaggacatcagcagcgtctacgagatccgcgagaggctcggctcggggccctccccgctccactctctctccctcctgcctctcctctcttcccacttccttcccacctcccaccgccccgtctgcggcaggggtgccttctccgaggtggtgctggcccaggagcggggctccgcacacctcgtggccctcaagtgcatccccaagaaggccctccggggcaaggaggccctggtggagaacgagatcgcagtgctccgtaggatcagtcaccccaacatcgtcgctctggaggatgtccacgagagcccttcccacctctacctggccatggaactgtga
Sequence Length
366
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,356 Da
NCBI Official Full Name
Homo sapiens pregnancy up-regulated non-ubiquitously expressed CaM kinase, mRNA
NCBI Official Synonym Full Names
pregnancy up-regulated nonubiquitous CaM kinase
NCBI Official Symbol
PNCK
NCBI Official Synonym Symbols
BSTK3; CaMK1b
NCBI Protein Information
calcium/calmodulin-dependent protein kinase type 1B
UniProt Protein Name
Calcium/calmodulin-dependent protein kinase type 1B
UniProt Gene Name
PNCK
UniProt Synonym Gene Names
CaM kinase IB; CaM-KI beta; CaMKI-beta
UniProt Entry Name
KCC1B_HUMAN

NCBI Description

PNCK is a member of the calcium/calmodulin-dependent protein kinase family of protein serine/threonine kinases (see CAMK1; MIM 604998) (Gardner et al., 2000 [PubMed 10673339]).[supplied by OMIM, Mar 2008]

Uniprot Description

CAMK1B: Calcium/calmodulin-dependent protein kinase belonging to a proposed calcium-triggered signaling cascade. In vitro phosphorylates CREB1 and SYN1/synapsin I. Phosphorylates and activates CAMK1. Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family. CaMK subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein kinase, Ser/Thr (non-receptor); Protein kinase, CAMK; Kinase, protein; EC 2.7.11.17; CAMK group; CAMK1 family

Chromosomal Location of Human Ortholog: Xq28

Research Articles on PNCK

Similar Products

Product Notes

The PNCK pnck (Catalog #AAA1273076) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgc tgaagaaaca cacggaggac atcagcagcg tctacgagat ccgcgagagg ctcggctcgg ggccctcccc gctccactct ctctccctcc tgcctctcct ctcttcccac ttccttccca cctcccaccg ccccgtctgc ggcaggggtg ccttctccga ggtggtgctg gcccaggagc ggggctccgc acacctcgtg gccctcaagt gcatccccaa gaaggccctc cggggcaagg aggccctggt ggagaacgag atcgcagtgc tccgtaggat cagtcacccc aacatcgtcg ctctggagga tgtccacgag agcccttccc acctctacct ggccatggaa ctgtga. It is sometimes possible for the material contained within the vial of "PNCK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.