Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLS1 cdna clone

PLS1 cDNA Clone

Synonyms
PLS1; PLS1 cDNA Clone; PLS1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaaacagtactactaccatttctcgggaggagcttgaagaactacaagaggcatttaataaaatagatattgacaatagtgggtatgtcagtgactatgaacttcaagacctgtttaaggaagcaagccttcctctgcctggctacaaggtgcgcgagattgtggagaaaattctatcagttgctgacagcaacaaagatggcaaaatcagttttgaagagtttgtgtcactaatgcaagaattaaaaagcaaagatatcagcaaaacattccgaaaaataattaacaagagggaagggattactgctattggaggaacttcaactatttccagtgagggcacacagcattcttactcagaggaagaaaaagtggcttttgttaactggataaacaaagccctggagaatgaccctgactgtaagcatcttatacccatgaatcccaatgatgatagtcttttcaagtcacttgcagatggcatccttctttgcaaaatgatcaacttatctgaaccagatacaattgatgaaagagccatcaataagaaaaagctcacgccattcactatttctgaaaatttaaacctagctctgaattctgcctcagccattggttgtacagtggtcaacattggtgcatcagatctcaaagaaggaaaacctcacttggtcttgggacttctctggcagatcatcaaagttggcctttttgctgatattgagatttccaggaatgaagctctgattgcattgttaaatgaaggtgaggaactagaggagctgatgaagctttctcccgaggaattactgctgcgatgggtgaactaccatctgaccaatgcaggatggcataccatcagcaacttcagccaagacattaaggactcgagagcctattttcatctgcttaatcagattgcccctaaaggtggggaagatggacctgccattgccattgacctttcaggaattaatgagacaaatgacctgaagcgtgctggactcatgcttcaagaagcagataaactgggctgcaaacagtttgttactcctgcagatgtggtttcaggcaatcctaaacttaatttagcttttgtagctaatttgtttaacacatacccatgcctgcacaagccgaataataatgacatcgatatgaatttactggaaggagagagcaaggaagagagaacatttcggaactggatgaattccttgggagtcaacccatacattaatcatttgtacagtgaccttgcagatgctttagtgatctttcagctctatgagatgatccgagtgccagtcaactggagacatgtcaacaaacctccttatcctgcccttggagggaacatgaagaagattgaaaactgtaactatgcagtggaacttgggaagaacaaggccaaattctccttggttggcattgctgggcaggacctaaatgaagggaattcaacacttaccctggcattggtatggcagctgatgagaaggtacacattgaatgtgttatcggatcttggagagggtgaaaaagtaaatgatgaaattataattaaatgggtcaatcagactcttaaaagtgcaaacaaaaagacttctatttccagcttcaaggataaatctataagcacaagtttacctgtcctagatttaatagatgccattgcaccaaatgcagttcgtcaagaaatgatcaggagagaaaacttatctgatgaggacaagctgaacaatgctaaatacgccatttcagttgctcgaaagatcggtgcccggatatatgcattacctgatgacctcgtagaagtgaaaccaaagatggttatgacggtgtttgcatgcttaatgggaaaaggactgaacagaataaaataa
Sequence Length
1890
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
70,253 Da
NCBI Official Full Name
Homo sapiens plastin 1 (I isoform), mRNA
NCBI Official Synonym Full Names
plastin 1
NCBI Official Symbol
PLS1
NCBI Protein Information
plastin-1
UniProt Protein Name
Plastin-1
Protein Family
UniProt Gene Name
PLS1
UniProt Synonym Gene Names
I-plastin
UniProt Entry Name
PLSI_HUMAN

NCBI Description

Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]

Uniprot Description

PLS1: Actin-bundling protein in the absence of calcium.

Protein type: Actin-binding; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 3q23

Cellular Component: brush border

Molecular Function: structural constituent of cytoskeleton

Similar Products

Product Notes

The PLS1 pls1 (Catalog #AAA1275763) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaaaca gtactactac catttctcgg gaggagcttg aagaactaca agaggcattt aataaaatag atattgacaa tagtgggtat gtcagtgact atgaacttca agacctgttt aaggaagcaa gccttcctct gcctggctac aaggtgcgcg agattgtgga gaaaattcta tcagttgctg acagcaacaa agatggcaaa atcagttttg aagagtttgt gtcactaatg caagaattaa aaagcaaaga tatcagcaaa acattccgaa aaataattaa caagagggaa gggattactg ctattggagg aacttcaact atttccagtg agggcacaca gcattcttac tcagaggaag aaaaagtggc ttttgttaac tggataaaca aagccctgga gaatgaccct gactgtaagc atcttatacc catgaatccc aatgatgata gtcttttcaa gtcacttgca gatggcatcc ttctttgcaa aatgatcaac ttatctgaac cagatacaat tgatgaaaga gccatcaata agaaaaagct cacgccattc actatttctg aaaatttaaa cctagctctg aattctgcct cagccattgg ttgtacagtg gtcaacattg gtgcatcaga tctcaaagaa ggaaaacctc acttggtctt gggacttctc tggcagatca tcaaagttgg cctttttgct gatattgaga tttccaggaa tgaagctctg attgcattgt taaatgaagg tgaggaacta gaggagctga tgaagctttc tcccgaggaa ttactgctgc gatgggtgaa ctaccatctg accaatgcag gatggcatac catcagcaac ttcagccaag acattaagga ctcgagagcc tattttcatc tgcttaatca gattgcccct aaaggtgggg aagatggacc tgccattgcc attgaccttt caggaattaa tgagacaaat gacctgaagc gtgctggact catgcttcaa gaagcagata aactgggctg caaacagttt gttactcctg cagatgtggt ttcaggcaat cctaaactta atttagcttt tgtagctaat ttgtttaaca catacccatg cctgcacaag ccgaataata atgacatcga tatgaattta ctggaaggag agagcaagga agagagaaca tttcggaact ggatgaattc cttgggagtc aacccataca ttaatcattt gtacagtgac cttgcagatg ctttagtgat ctttcagctc tatgagatga tccgagtgcc agtcaactgg agacatgtca acaaacctcc ttatcctgcc cttggaggga acatgaagaa gattgaaaac tgtaactatg cagtggaact tgggaagaac aaggccaaat tctccttggt tggcattgct gggcaggacc taaatgaagg gaattcaaca cttaccctgg cattggtatg gcagctgatg agaaggtaca cattgaatgt gttatcggat cttggagagg gtgaaaaagt aaatgatgaa attataatta aatgggtcaa tcagactctt aaaagtgcaa acaaaaagac ttctatttcc agcttcaagg ataaatctat aagcacaagt ttacctgtcc tagatttaat agatgccatt gcaccaaatg cagttcgtca agaaatgatc aggagagaaa acttatctga tgaggacaag ctgaacaatg ctaaatacgc catttcagtt gctcgaaaga tcggtgcccg gatatatgca ttacctgatg acctcgtaga agtgaaacca aagatggtta tgacggtgtt tgcatgctta atgggaaaag gactgaacag aataaaataa. It is sometimes possible for the material contained within the vial of "PLS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.