Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLK3 cdna clone

PLK3 cDNA Clone

Gene Names
PLK3; CNK; FNK; PRK; PLK-3
Synonyms
PLK3; PLK3 cDNA Clone; PLK3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcctgccgccggtttcctgtctccgcgccccttccagcgtgcggccgccgcgcccgctcccccggccgggcccgggccgcctccgagtgccttgcgcggacctgagctggagatgctggccgggctaccgacgtcagaccccgggcgcctcatcacggacccgcgcagcggccgcacctacctcaaaggccgcttgttgggcaaggggggcttcgcccgctgctacgaggccactgacacagagactggcagcgcctacgctgtcaaagtcatcccgcagagccgcgtcgccaagccgcatcagcgcgagaagatcctaaatgagattgagctgcaccgagacctgcagcaccgccacatcgtgcgtttttcgcaccactttgaggacgctgacaacatctacattttcttggagctctgcagccgaaagtccctggcccacatctggaaggcccggcacaccctgttggagccagaagtgcgctactacctgcggcagatcctttctggcctcaagtacttgcaccagcgcggcatcttgcaccgggacctcaagttgggaaattttttcatcactgagaacatggaactgaaggtgggggattttgggctggcagcccggttggagcctccggagcagaggaagaagaccatctgtggcacccccaactatgtggctccagaagtgctgctgagacagggccacggccctgaggcggatgtatggtcactgggctgtgtcatgtacacgctgctctgcgggagccctccctttgagacggctgacctgaaggagacgtaccgctgcatcaagcaggttcactacacgctgcctgccagcctctcactgcctgcccggcagctcctggccgccatccttcgggcctcaccccgagaccgcccctctattgaccagatcctgcgccatgacttctttaccaagggctacacccccgatcgactccctatcagcagctgcgtgacagtcccagacctgacaccccccaacccagctaggagtctgtttgccaaagttaccaagagcctctttggcagaaagaagaagagtaagaatcatgcccaggagagggatgaggtctccggtttggtgagcggcctcatgcgcacatccgttggccatcaggatgccaggccagaggctccagcagcttctggcccagcccctgtcagcctggtagagacagcacctgaagacagctcaccccgtgggacactggcaagcagtggagatggatttgaagaaggtctgactgtggccacagtagtggagtcagccctttgtgctctgagaaattgtatagccttcatgcccccagcggaacagaacccggcccccctggcccagccagagcctctggtgtgggtcagcaagtgggttgactactccaataagttcggctttgggtatcaactgtccagccgccgtgtggctgtgctcttcaacaatggcacacatatggccctgtcggccaacagaaagactgtgcactacaatcccaccagcacaaagcacttctccttctccgtgggtgctgtgccccgggccctgcagcctcagctgggtatcctgcggtacttcgcctcctacatggagcagcacctcatgaagggtggagatctgcccagtgtggaagaggtagaggtacctgctccgcccttgctgctgcagtgggtcaagacggatcaggctctcctcatgctgtttagtgatggcactgtccaggtgaacttctacggggaccacaccaagctgattctcagtggctgggagcccctccttgtgacttttgtggcccgaaatcgtagtgcttgtacttacctcgcttcccaccttcggcagctgggctgctctccagacctgcggcagcgactccgctatgctctgcgcctgctccgggaccgcagcccagcctag
Sequence Length
1941
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
71,629 Da
NCBI Official Full Name
Homo sapiens polo-like kinase 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
polo like kinase 3
NCBI Official Symbol
PLK3
NCBI Official Synonym Symbols
CNK; FNK; PRK; PLK-3
NCBI Protein Information
serine/threonine-protein kinase PLK3
UniProt Protein Name
Serine/threonine-protein kinase PLK3
UniProt Gene Name
PLK3
UniProt Synonym Gene Names
CNK; FNK; PRK; PLK-3
UniProt Entry Name
PLK3_HUMAN

NCBI Description

The protein encoded by this gene is a member of the highly conserved polo-like kinase family of serine/threonine kinases. Members of this family are characterized by an amino-terminal kinase domain and a carboxy-terminal bipartite polo box domain that functions as a substrate-binding motif and a cellular localization signal. Polo-like kinases are important regulators of cell cycle progression. This gene has also been implicated in stress responses and double-strand break repair. In human cell lines, this protein is reported to associate with centrosomes in a microtubule-dependent manner, and during mitosis, the protein becomes localized to the mitotic apparatus. Expression of a kinase-defective mutant results in abnormal cell morphology caused by changes in microtubule dynamics and mitotic arrest followed by apoptosis. [provided by RefSeq, Sep 2015]

Uniprot Description

PLK3: a kinase of the PLK family. Phosphorylated and activated following DNA damage or mitotic spindle disruption. Interacts with Chk2 and the interaction is enhanced upon DNA damage. Apparent substrates include Chk2 and p53. Plays an important role in regulating microtubule dynamics and centrosomal function. Deregulated expression of Plk3 results in cell cycle arrest and apoptosis.

Protein type: Protein kinase, Ser/Thr (non-receptor); Protein kinase, Other; Nucleolus; Kinase, protein; EC 2.7.11.21; Other group; PLK family

Chromosomal Location of Human Ortholog: 1p34.1

Cellular Component: centrosome; cytoplasm; Golgi stack; nucleolus; nucleoplasm; nucleus

Molecular Function: p53 binding; protein binding; protein serine/threonine kinase activity

Biological Process: apoptosis; cytoplasmic microtubule organization and biogenesis; DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; endomitotic cell cycle; G1/S transition of mitotic cell cycle; G2/M transition of mitotic cell cycle; mitotic cell cycle checkpoint; negative regulation of apoptosis; negative regulation of transcription from RNA polymerase II promoter; protein kinase B signaling cascade; regulation of cell division; regulation of cytokinesis; response to DNA damage stimulus; response to osmotic stress; response to radiation; response to reactive oxygen species

Research Articles on PLK3

Similar Products

Product Notes

The PLK3 plk3 (Catalog #AAA1271599) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcctg ccgccggttt cctgtctccg cgccccttcc agcgtgcggc cgccgcgccc gctcccccgg ccgggcccgg gccgcctccg agtgccttgc gcggacctga gctggagatg ctggccgggc taccgacgtc agaccccggg cgcctcatca cggacccgcg cagcggccgc acctacctca aaggccgctt gttgggcaag gggggcttcg cccgctgcta cgaggccact gacacagaga ctggcagcgc ctacgctgtc aaagtcatcc cgcagagccg cgtcgccaag ccgcatcagc gcgagaagat cctaaatgag attgagctgc accgagacct gcagcaccgc cacatcgtgc gtttttcgca ccactttgag gacgctgaca acatctacat tttcttggag ctctgcagcc gaaagtccct ggcccacatc tggaaggccc ggcacaccct gttggagcca gaagtgcgct actacctgcg gcagatcctt tctggcctca agtacttgca ccagcgcggc atcttgcacc gggacctcaa gttgggaaat tttttcatca ctgagaacat ggaactgaag gtgggggatt ttgggctggc agcccggttg gagcctccgg agcagaggaa gaagaccatc tgtggcaccc ccaactatgt ggctccagaa gtgctgctga gacagggcca cggccctgag gcggatgtat ggtcactggg ctgtgtcatg tacacgctgc tctgcgggag ccctcccttt gagacggctg acctgaagga gacgtaccgc tgcatcaagc aggttcacta cacgctgcct gccagcctct cactgcctgc ccggcagctc ctggccgcca tccttcgggc ctcaccccga gaccgcccct ctattgacca gatcctgcgc catgacttct ttaccaaggg ctacaccccc gatcgactcc ctatcagcag ctgcgtgaca gtcccagacc tgacaccccc caacccagct aggagtctgt ttgccaaagt taccaagagc ctctttggca gaaagaagaa gagtaagaat catgcccagg agagggatga ggtctccggt ttggtgagcg gcctcatgcg cacatccgtt ggccatcagg atgccaggcc agaggctcca gcagcttctg gcccagcccc tgtcagcctg gtagagacag cacctgaaga cagctcaccc cgtgggacac tggcaagcag tggagatgga tttgaagaag gtctgactgt ggccacagta gtggagtcag ccctttgtgc tctgagaaat tgtatagcct tcatgccccc agcggaacag aacccggccc ccctggccca gccagagcct ctggtgtggg tcagcaagtg ggttgactac tccaataagt tcggctttgg gtatcaactg tccagccgcc gtgtggctgt gctcttcaac aatggcacac atatggccct gtcggccaac agaaagactg tgcactacaa tcccaccagc acaaagcact tctccttctc cgtgggtgct gtgccccggg ccctgcagcc tcagctgggt atcctgcggt acttcgcctc ctacatggag cagcacctca tgaagggtgg agatctgccc agtgtggaag aggtagaggt acctgctccg cccttgctgc tgcagtgggt caagacggat caggctctcc tcatgctgtt tagtgatggc actgtccagg tgaacttcta cggggaccac accaagctga ttctcagtgg ctgggagccc ctccttgtga cttttgtggc ccgaaatcgt agtgcttgta cttacctcgc ttcccacctt cggcagctgg gctgctctcc agacctgcgg cagcgactcc gctatgctct gcgcctgctc cgggaccgca gcccagccta g. It is sometimes possible for the material contained within the vial of "PLK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.