Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLEKHF1 cdna clone

PLEKHF1 cDNA Clone

Gene Names
PLEKHF1; APPD; LAPF; PHAFIN1; ZFYVE15
Synonyms
PLEKHF1; PLEKHF1 cDNA Clone; PLEKHF1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggaccacttggccaacacggagatcaacagccagcgcatcgcggcagtggagagctgcttcggggcctcggggcagccgctggcgctgccaggccgagtgctgctgggcgagggcgtgctgaccaaagagtgccgcaagaaggccaagccgcgcatcttcttcctctttaacgacatcctggtgtatggcagcatcgtgctcaacaagcgcaagtaccgcagccagcacatcatccccctggaggaggtcacactggagctgttgccggagacgctgcaggccaagaaccgctggatgatcaagacggccaagaagtcctttgtggtgtcggccgcctccgctacggagcgccaggaatggattagccacatcgaggagtgcgtgcggcggcaactgagggccacgggccgcccgcccagcacggagcacgcggcaccctggatccccgacaaggccacggacatctgcatgcgctgcacgcagacgcgcttctctgccctcacgaggcgccaccactgccgcaagtgcggcttcgtggtctgcgctgagtgctcgcgccagcgcttcctgctcccgcgcctgtcccccaagcccgtgcgcgtctgcagcctctgctaccgcgaactggccgcccagcagcggcaggaggaggcggaggagcagggcgcggggtccccagggcagccagcccacctggcccggcccatctgcggagcgtccagtggagatgacgatgactccgacgaggacaaggagggcagcagggacggcgactggcccagcagcgtggagttctacgcctcgggggtggcctggtctgccttccacagctga
Sequence Length
840
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,195 Da
NCBI Official Full Name
Homo sapiens pleckstrin homology domain containing, family F (with FYVE domain) member 1, mRNA
NCBI Official Synonym Full Names
pleckstrin homology and FYVE domain containing 1
NCBI Official Symbol
PLEKHF1
NCBI Official Synonym Symbols
APPD; LAPF; PHAFIN1; ZFYVE15
NCBI Protein Information
pleckstrin homology domain-containing family F member 1
UniProt Protein Name
Pleckstrin homology domain-containing family F member 1
UniProt Gene Name
PLEKHF1
UniProt Synonym Gene Names
APPD; LAPF; ZFYVE15; PH domain-containing family F member 1; Apoptosis-inducing protein
UniProt Entry Name
PKHF1_HUMAN

Uniprot Description

PKHF1: May induce apoptosis through the lysosomal-mitochondrial pathway. Translocates to the lysosome initiating the permeabilization of lysosomal membrane (LMP) and resulting in the release of CTSD and CTSL to the cytoplasm. Triggers the caspase- independent apoptosis by altering mitochondrial membrane permeabilization (MMP) resulting in the release of PDCD8.

Chromosomal Location of Human Ortholog: 19q12

Cellular Component: endosome; endosome membrane; lysosomal membrane; lysosome

Molecular Function: phosphatidylinositol 3-phosphate binding; phosphatidylinositol-5-phosphate binding; protein binding

Biological Process: endosome organization and biogenesis; positive regulation of autophagy; vesicle organization and biogenesis

Research Articles on PLEKHF1

Similar Products

Product Notes

The PLEKHF1 plekhf1 (Catalog #AAA1273531) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggacc acttggccaa cacggagatc aacagccagc gcatcgcggc agtggagagc tgcttcgggg cctcggggca gccgctggcg ctgccaggcc gagtgctgct gggcgagggc gtgctgacca aagagtgccg caagaaggcc aagccgcgca tcttcttcct ctttaacgac atcctggtgt atggcagcat cgtgctcaac aagcgcaagt accgcagcca gcacatcatc cccctggagg aggtcacact ggagctgttg ccggagacgc tgcaggccaa gaaccgctgg atgatcaaga cggccaagaa gtcctttgtg gtgtcggccg cctccgctac ggagcgccag gaatggatta gccacatcga ggagtgcgtg cggcggcaac tgagggccac gggccgcccg cccagcacgg agcacgcggc accctggatc cccgacaagg ccacggacat ctgcatgcgc tgcacgcaga cgcgcttctc tgccctcacg aggcgccacc actgccgcaa gtgcggcttc gtggtctgcg ctgagtgctc gcgccagcgc ttcctgctcc cgcgcctgtc ccccaagccc gtgcgcgtct gcagcctctg ctaccgcgaa ctggccgccc agcagcggca ggaggaggcg gaggagcagg gcgcggggtc cccagggcag ccagcccacc tggcccggcc catctgcgga gcgtccagtg gagatgacga tgactccgac gaggacaagg agggcagcag ggacggcgac tggcccagca gcgtggagtt ctacgcctcg ggggtggcct ggtctgcctt ccacagctga. It is sometimes possible for the material contained within the vial of "PLEKHF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.