PLCXD1 cdna clone
PLCXD1 cDNA Clone
Gene Names
PLCXD1; LL0XNC01-136G2.1
Synonyms
PLCXD1; PLCXD1 cDNA Clone; PLCXD1 cdna clone
Sequence
atgggcgggcaggtgagcgcttccaacagcttctcgaggctgcactgcagaaatgccaacgaggactggatgtcggcactgtgtccccggctctgggatgtgcccctccaccacctctccatcccagggagccacgacacgatgacgtactgcctgaacaagaagtcccccatttcgcacgaggagtcccggctgctgcagctgctgaacaaggccttgccctgcatcacgcgccctgtcgtgctgaaatggtccgtcacccaggcactggacgtcacagagcagctggatgccggggtgcggtacctggacctgcggatagcccacatgctggagggctcggagaagaacctgcactttgtccatatggtgtacacaacggcgctggtggaggacacactcacggaaatctcggagtggctggagcggcatccacgcgaggtggtcatcctggcctgcagaaacttcgaggggctgagcgaggacctgcacgagtacctggtcgcctgtatcaagaacatcttcggggacatgctgtgtcctcgtggggaggtgccgacactgcggcagctgtggtcccggggccaacaggtcatcgtctcctatgaagacgagagctccttgcgccggcaccacgagctgtggccaggagtcccctactggtggggaaacagggtgaagaccgaggccctcatccgatacctggagaccatgaagagctgcggccgcccaggagggttgttcgtggccggcatcaacctcacggagaacctgcagtacgttctggcgcacccgtccgagtccctggagaagatgacgctgcccaaccttccgcggctgagcgcgtgggtccgagagcagtgcccggggccgggttcacggtgcaccaacatcatcgcgggggacttcatcggcgcagacggcttcgtcagtgacgtcatcgcgctcaatcagaagctgctgtggtgctga
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,668 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol-specific phospholipase C, X domain containing 1, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol specific phospholipase C X domain containing 1
NCBI Official Symbol
PLCXD1
NCBI Official Synonym Symbols
LL0XNC01-136G2.1
NCBI Protein Information
PI-PLC X domain-containing protein 1
UniProt Protein Name
PI-PLC X domain-containing protein 1
Protein Family
UniProt Gene Name
PLCXD1
UniProt Entry Name
PLCX1_HUMAN
NCBI Description
This gene is the most terminal protein-coding gene in the pseudoautosomal (PAR) region on chromosomes X and Y. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Uniprot Description
PLCXD1:
Chromosomal Location of Human Ortholog: Xp22.33; Yp11.32
Similar Products
Product Notes
The PLCXD1 plcxd1 (Catalog #AAA1270161) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcgggc aggtgagcgc ttccaacagc ttctcgaggc tgcactgcag aaatgccaac gaggactgga tgtcggcact gtgtccccgg ctctgggatg tgcccctcca ccacctctcc atcccaggga gccacgacac gatgacgtac tgcctgaaca agaagtcccc catttcgcac gaggagtccc ggctgctgca gctgctgaac aaggccttgc cctgcatcac gcgccctgtc gtgctgaaat ggtccgtcac ccaggcactg gacgtcacag agcagctgga tgccggggtg cggtacctgg acctgcggat agcccacatg ctggagggct cggagaagaa cctgcacttt gtccatatgg tgtacacaac ggcgctggtg gaggacacac tcacggaaat ctcggagtgg ctggagcggc atccacgcga ggtggtcatc ctggcctgca gaaacttcga ggggctgagc gaggacctgc acgagtacct ggtcgcctgt atcaagaaca tcttcgggga catgctgtgt cctcgtgggg aggtgccgac actgcggcag ctgtggtccc ggggccaaca ggtcatcgtc tcctatgaag acgagagctc cttgcgccgg caccacgagc tgtggccagg agtcccctac tggtggggaa acagggtgaa gaccgaggcc ctcatccgat acctggagac catgaagagc tgcggccgcc caggagggtt gttcgtggcc ggcatcaacc tcacggagaa cctgcagtac gttctggcgc acccgtccga gtccctggag aagatgacgc tgcccaacct tccgcggctg agcgcgtggg tccgagagca gtgcccgggg ccgggttcac ggtgcaccaa catcatcgcg ggggacttca tcggcgcaga cggcttcgtc agtgacgtca tcgcgctcaa tcagaagctg ctgtggtgct ga. It is sometimes possible for the material contained within the vial of "PLCXD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
