Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLA2G15 cdna clone

PLA2G15 cDNA Clone

Gene Names
PLA2G15; ACS; LLPL; LPLA2; LYPLA3; GXVPLA2
Synonyms
PLA2G15; PLA2G15 cDNA Clone; PLA2G15 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggagagccttgtgggctggggctacacacggggtgaggatgtccgaggggctccctatgactggcgccgagccccaaatgaaaacgggccctacttcctggccctccgcgagatgatcgaggagatgtaccagctgtatgggggccctgtggtgctggttgcccacagtatgggcaacatgtacacgctctactttctgcagcggcagccgcaggcctggaaggacaagtatatccgggccttcgtgtcactgggtgcgccctgggggggcgtggccaagaccctgcgcgtcctggcttcaggagacaacaaccggatcccagtcatcgggcccctgaagatccgggagcagcagcggtcagctgtctccaccagctggctgctgccctacaactacacatggtcacctgagaaggtgttcgtgcagacacccacaatcaactacacactgcgggactaccgcaagttcttccaggacatcggctttgaagatggctggctcatgcggcaggacacagaagggctggtggaagccacgatgccacctggcgtgcagctgcactgcctctatggtactggcgtccccacaccagactccttctactatgagagcttccctgaccgtgaccctaaaatctgctttggtgacggcgatggtactgtgaacttgaagagtgccctgcagtgccaggcctggcagagccgccaggagcaccaagtgttgctgcaggagctgccaggcagcgagcacatcgagatgctggccaacgccaccaccctggcctatctgaaacgtgtgctccttgggccctga
Sequence Length
819
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,717 Da
NCBI Official Full Name
Homo sapiens phospholipase A2, group XV, mRNA
NCBI Official Synonym Full Names
phospholipase A2 group XV
NCBI Official Symbol
PLA2G15
NCBI Official Synonym Symbols
ACS; LLPL; LPLA2; LYPLA3; GXVPLA2
NCBI Protein Information
group XV phospholipase A2
UniProt Protein Name
Group XV phospholipase A2
Protein Family
UniProt Gene Name
PLA2G15
UniProt Synonym Gene Names
LYPLA3; LPLA2
UniProt Entry Name
PAG15_HUMAN

NCBI Description

Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene hydrolyzes lysophosphatidylcholine to glycerophosphorylcholine and a free fatty acid. This enzyme is present in the plasma and thought to be associated with high-density lipoprotein. A later paper contradicts the function of this gene. It demonstrates that this gene encodes a lysosomal enzyme instead of a lysophospholipase and has both calcium-independent phospholipase A2 and transacylase activities. [provided by RefSeq, Jul 2008]

Uniprot Description

LYPLA3: Has transacylase and calcium-independent phospholipase A2 activity. Catalyzes the formation of 1-O-acyl-N- acetylsphingosine and the concomitant release of a lyso- phospholipid. May have weak lysophospholipase activity. Belongs to the AB hydrolase superfamily. Lipase family.

Protein type: Lipid Metabolism - glycerophospholipid; EC 2.3.1.-; Secreted; Phospholipase; Transferase; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: extracellular space; lysosome

Molecular Function: calcium-independent phospholipase A2 activity; lysophospholipase activity; O-acyltransferase activity; phospholipid binding

Biological Process: ceramide metabolic process; fatty acid catabolic process; glycerophospholipid metabolic process; phosphatidylethanolamine catabolic process

Research Articles on PLA2G15

Similar Products

Product Notes

The PLA2G15 pla2g15 (Catalog #AAA1277005) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggaga gccttgtggg ctggggctac acacggggtg aggatgtccg aggggctccc tatgactggc gccgagcccc aaatgaaaac gggccctact tcctggccct ccgcgagatg atcgaggaga tgtaccagct gtatgggggc cctgtggtgc tggttgccca cagtatgggc aacatgtaca cgctctactt tctgcagcgg cagccgcagg cctggaagga caagtatatc cgggccttcg tgtcactggg tgcgccctgg gggggcgtgg ccaagaccct gcgcgtcctg gcttcaggag acaacaaccg gatcccagtc atcgggcccc tgaagatccg ggagcagcag cggtcagctg tctccaccag ctggctgctg ccctacaact acacatggtc acctgagaag gtgttcgtgc agacacccac aatcaactac acactgcggg actaccgcaa gttcttccag gacatcggct ttgaagatgg ctggctcatg cggcaggaca cagaagggct ggtggaagcc acgatgccac ctggcgtgca gctgcactgc ctctatggta ctggcgtccc cacaccagac tccttctact atgagagctt ccctgaccgt gaccctaaaa tctgctttgg tgacggcgat ggtactgtga acttgaagag tgccctgcag tgccaggcct ggcagagccg ccaggagcac caagtgttgc tgcaggagct gccaggcagc gagcacatcg agatgctggc caacgccacc accctggcct atctgaaacg tgtgctcctt gggccctga. It is sometimes possible for the material contained within the vial of "PLA2G15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.