PKD2L2 cdna clone
PKD2L2 cDNA Clone
Gene Names
PKD2L2; TRPP5
Synonyms
PKD2L2; PKD2L2 cDNA Clone; PKD2L2 cdna clone
Sequence
atggctgaggcgtcacggtggcaccgaggcggggcttcgaaacataagttgcattacagaaaggaagtagaaattacaaccacacttcaggaattgttactctactttatttttttaataaacctatgtatattgacttttgggatggtaaacccacatatgtattacttaaacaaggttatgtcatctctatttttggacacttctgtgcctggtgaagaaagaaccaactttaagtccattcgcagcataactgatttttggaagtttatggaaggaccccttttggaaggtctgtactgggattcatggtacaataaccagcagctgtataatttaaagaacagcagtcgcatctactatgaaaatatacttctaggagttcccagagttcgtcaactaaaagtccgcaacaacacatgcaaagtctattcatcttttcagtctttgatgagtgaatgttatggcaaatatacttctgcaaatgaagacctctctaattttggccttcaaattaatactgaatggagatattctacttctaataccaactccccttggcactggggatttcttggtgtttaccgaaatgggggatacattttcactttatcaaaatcgaaatctgaaaccaaaaacaagttcattgaccttcgactgaacagctggatcacaagagggactagagttatttttattgatttttccttatataatgctaatgtaaatctattttgtattatcagattggtggcagaattccctgcaactggaggaatacttacttcatggcagttttactctgtgaagctcctcagatatgttagctactatgactattttattgcttcctgtgaaatcacattctgtatttttctttttgtcttcacaacacaagaagtcaaaaaaataaaagaatttaagtctgcctatttcaaaagtatttggaactggctagaattgctacttttgctgttgtgttttgtggctgtttccttcaacacatactataatgtacaaatttttctcttacttggacagctgttgaaaagtactgaaaaatattcagatttctattttcttgcatgctggcacatttattacaataatataattgctattaccatcttttttgcatggataaagaatatgttcttggcaattattaatgatacctattctgaagtgaaagctgactattcaataggcagaaggccagattttgaacttggcaaaatgattaaacagagttacaaaaatgttctcgagaaattcagactgaagaaagctcaaaaagatgaagacaagaaaaccaaaggcagcggagatttggctgaacaagccagaagagaaggctttgacgaaaatgagattcaaaacgcagagcagatgaaaaaatggaaagagaggcttgagaaaaagtattattctatggaaattcaagatgactaccagcctgtcactcaagaagaatttcgagaactttttttatatgctgtggagctggagaaggaattacactacatcaatttgaagctaaatcaagtggtgagaaaggtttcagctctatag
Sequence Length
1572
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
71,255 Da
NCBI Official Full Name
Homo sapiens polycystic kidney disease 2-like 2, mRNA
NCBI Official Synonym Full Names
polycystin 2 like 2, transient receptor potential cation channel
NCBI Official Symbol
PKD2L2
NCBI Official Synonym Symbols
TRPP5
NCBI Protein Information
polycystic kidney disease 2-like 2 protein
UniProt Protein Name
Polycystic kidney disease 2-like 2 protein
Protein Family
UniProt Gene Name
PKD2L2
UniProt Entry Name
PK2L2_HUMAN
Uniprot Description
PKD2L2: May function as a subunit of a cation channel and play a role in fertilization. Belongs to the polycystin family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 5q31
Cellular Component: integral to membrane
Molecular Function: calcium channel activity
Biological Process: detection of mechanical stimulus
Similar Products
Product Notes
The PKD2L2 pkd2l2 (Catalog #AAA1266328) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgagg cgtcacggtg gcaccgaggc ggggcttcga aacataagtt gcattacaga aaggaagtag aaattacaac cacacttcag gaattgttac tctactttat ttttttaata aacctatgta tattgacttt tgggatggta aacccacata tgtattactt aaacaaggtt atgtcatctc tatttttgga cacttctgtg cctggtgaag aaagaaccaa ctttaagtcc attcgcagca taactgattt ttggaagttt atggaaggac cccttttgga aggtctgtac tgggattcat ggtacaataa ccagcagctg tataatttaa agaacagcag tcgcatctac tatgaaaata tacttctagg agttcccaga gttcgtcaac taaaagtccg caacaacaca tgcaaagtct attcatcttt tcagtctttg atgagtgaat gttatggcaa atatacttct gcaaatgaag acctctctaa ttttggcctt caaattaata ctgaatggag atattctact tctaatacca actccccttg gcactgggga tttcttggtg tttaccgaaa tgggggatac attttcactt tatcaaaatc gaaatctgaa accaaaaaca agttcattga ccttcgactg aacagctgga tcacaagagg gactagagtt atttttattg atttttcctt atataatgct aatgtaaatc tattttgtat tatcagattg gtggcagaat tccctgcaac tggaggaata cttacttcat ggcagtttta ctctgtgaag ctcctcagat atgttagcta ctatgactat tttattgctt cctgtgaaat cacattctgt atttttcttt ttgtcttcac aacacaagaa gtcaaaaaaa taaaagaatt taagtctgcc tatttcaaaa gtatttggaa ctggctagaa ttgctacttt tgctgttgtg ttttgtggct gtttccttca acacatacta taatgtacaa atttttctct tacttggaca gctgttgaaa agtactgaaa aatattcaga tttctatttt cttgcatgct ggcacattta ttacaataat ataattgcta ttaccatctt ttttgcatgg ataaagaata tgttcttggc aattattaat gatacctatt ctgaagtgaa agctgactat tcaataggca gaaggccaga ttttgaactt ggcaaaatga ttaaacagag ttacaaaaat gttctcgaga aattcagact gaagaaagct caaaaagatg aagacaagaa aaccaaaggc agcggagatt tggctgaaca agccagaaga gaaggctttg acgaaaatga gattcaaaac gcagagcaga tgaaaaaatg gaaagagagg cttgagaaaa agtattattc tatggaaatt caagatgact accagcctgt cactcaagaa gaatttcgag aacttttttt atatgctgtg gagctggaga aggaattaca ctacatcaat ttgaagctaa atcaagtggt gagaaaggtt tcagctctat ag. It is sometimes possible for the material contained within the vial of "PKD2L2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
