Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIPOX cdna clone

PIPOX cDNA Clone

Gene Names
PIPOX; LPIPOX
Synonyms
PIPOX; PIPOX cDNA Clone; PIPOX cdna clone
Ordering
For Research Use Only!
Sequence
atggcggctcagaaagatctctgggacgccattgtgattggggcggggatccagggctgcttcactgcataccacctggccaaacacaggaagaggatcctcctgctggagcagttctttctaccacactcccgaggaagctcccatggacaaagccggataatccgaaaggcgtacctggaagacttttacacccggatgatgcatgagtgctatcagatatgggcccagctggagcacgaggctggaacccaattgcacaggcagactggattactgctgctgggaatgaaagagaatcaagaattaaagacaatccaggccaatctgtcgaggcagagggtagaacaccagtgtctttcatctgaggaactgaagcaacgtttcccaaatattcggttgcccaggggagaagtggggctcttggacaattccggaggagttatctatgcatataaggccctcagagccctgcaggatgcaattcgacagctaggaggcatagtgcgtgacggagagaaggtggtggagataaacccagggctactggtcacggtgaaaaccacctccaggagctaccaagctaagagcttggtcatcacagcaggtccttggaccaaccagctcctccgtcccctgggcattgagatgcctctccagaccctgcggatcaacgtgtgttactggcgagagatggttcctgggagctatggtgtgtcccaggcctttccgtgcttcctgtggctgggcttgtgtccccaccacatctacggactgcccacaggagagtacccagggctgatgaaggtcagctatcaccacggcaaccacgcagaccctgaggagcgggactgccccacagcacgcacagacatcggagacgtccagatcctgagcagctttgtcagagatcacttacctgatctgaagcccgagcctgctgtcattgagagctgcatgtacacgaatacccctgatgagcagttcattctcgatcgccacccaaagtatgacaacattgtcattggtgctggattctctgggcacgggttcaagctggcccctgtggtggggaagatcctgtatgaattaagcatgaaattaacaccatcttatgacttggcaccttttcgaatcagccgtttcccaagcctgggcaaagcccacctttga
Sequence Length
1173
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,066 Da
NCBI Official Full Name
Homo sapiens pipecolic acid oxidase, mRNA
NCBI Official Synonym Full Names
pipecolic acid and sarcosine oxidase
NCBI Official Symbol
PIPOX
NCBI Official Synonym Symbols
LPIPOX
NCBI Protein Information
peroxisomal sarcosine oxidase
UniProt Protein Name
Peroxisomal sarcosine oxidase
UniProt Gene Name
PIPOX
UniProt Synonym Gene Names
LPIPOX; PSO; PSO
UniProt Entry Name
SOX_HUMAN

Uniprot Description

PIPOX: Metabolizes sarcosine, L-pipecolic acid and L-proline. Belongs to the MSOX/MTOX family.

Protein type: EC 1.5.3.7; Amino Acid Metabolism - glycine, serine and threonine; Amino Acid Metabolism - lysine degradation; EC 1.5.3.1; Oxidoreductase

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: peroxisomal matrix; peroxisome

Molecular Function: L-pipecolate oxidase activity; protein binding; receptor binding; sarcosine oxidase activity

Biological Process: L-lysine catabolic process to acetyl-CoA via L-pipecolate; lysine catabolic process

Research Articles on PIPOX

Similar Products

Product Notes

The PIPOX pipox (Catalog #AAA1276969) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctc agaaagatct ctgggacgcc attgtgattg gggcggggat ccagggctgc ttcactgcat accacctggc caaacacagg aagaggatcc tcctgctgga gcagttcttt ctaccacact cccgaggaag ctcccatgga caaagccgga taatccgaaa ggcgtacctg gaagactttt acacccggat gatgcatgag tgctatcaga tatgggccca gctggagcac gaggctggaa cccaattgca caggcagact ggattactgc tgctgggaat gaaagagaat caagaattaa agacaatcca ggccaatctg tcgaggcaga gggtagaaca ccagtgtctt tcatctgagg aactgaagca acgtttccca aatattcggt tgcccagggg agaagtgggg ctcttggaca attccggagg agttatctat gcatataagg ccctcagagc cctgcaggat gcaattcgac agctaggagg catagtgcgt gacggagaga aggtggtgga gataaaccca gggctactgg tcacggtgaa aaccacctcc aggagctacc aagctaagag cttggtcatc acagcaggtc cttggaccaa ccagctcctc cgtcccctgg gcattgagat gcctctccag accctgcgga tcaacgtgtg ttactggcga gagatggttc ctgggagcta tggtgtgtcc caggcctttc cgtgcttcct gtggctgggc ttgtgtcccc accacatcta cggactgccc acaggagagt acccagggct gatgaaggtc agctatcacc acggcaacca cgcagaccct gaggagcggg actgccccac agcacgcaca gacatcggag acgtccagat cctgagcagc tttgtcagag atcacttacc tgatctgaag cccgagcctg ctgtcattga gagctgcatg tacacgaata cccctgatga gcagttcatt ctcgatcgcc acccaaagta tgacaacatt gtcattggtg ctggattctc tgggcacggg ttcaagctgg cccctgtggt ggggaagatc ctgtatgaat taagcatgaa attaacacca tcttatgact tggcaccttt tcgaatcagc cgtttcccaa gcctgggcaa agcccacctt tga. It is sometimes possible for the material contained within the vial of "PIPOX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.