Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIK3R3 cdna clone

PIK3R3 cDNA Clone

Gene Names
PIK3R3; p55; p55PIK; p55-GAMMA
Synonyms
PIK3R3; PIK3R3 cDNA Clone; PIK3R3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtacaatacggtgtggagtatggaccgcgatgacgcagactggagggaggtgatgatgccctattcgacagaactgatattttatattgaaatggatcctccagctcttccaccaaagccacctaagccaatgacttcagcagttccaaatggaatgaaggacagttctgtttctcttcaggatgcagaatggtactggggggatatttcaagggaggaggtaaatgacaaattgcgggatatgccagatgggaccttcttggtccgagatgcctcaacaaaaatgcagggagattatactttgactttgcggaagggaggcaataataagttaataaagatctatcaccgggatggtaaatatggcttttctgatcctctgacatttaattccgtggtggagctcattaaccactatcaccatgaatctcttgctcagtacaatcccaaacttgatgtgaagctgatgtacccagtgtccagataccaacaggatcagttggtaaaagaagataatattgatgcagtaggtaaaaaactgcaagaataccactctcagtatcaggagaagagtaaagagtatgataggctgtatgaagaatatactagaacatcccaggaaatacagatgaagaggactgcaatagaagcttttaatgaaacaattaaaatatttgaagagcagtgtcacacacaagaacaacatagcaaagaatatattgagcgatttcgcagagaggggaatgaaaaggagattgaacgaattatgatgaattatgataaattgaaatcacgtctgggtgagattcatgatagcaaaatgcgtctagagcaggatttgaagaatcaagctttggacaaccgagaaatagataaaaaaatgaatagcatcaaacctgacctgatccagctgcgaaagatccgagatcaacaccttgtatggctcaatcacaaaggagtgagacagaaacgcctgaatgtctggctgggaattaagaatgaggatgctgctgagaactattttatcaatgaggaagatgaaaacctgccccattatgatgagaaaacctggtttgttgaggatatcaatcgagtacaagcagaggacttgctttatgggaaacctgatggtgcattcttaattcgtgagagtagcaagaaaggatgctatgcttgctctgtggtggccgatggggaagtgaagcactgtgtgatctacagcactgctcggggctatggctttgcagagccctacaacctgtacagctctctgaaggagctagtgctccattaccagcagacatccttggttcagcacaacgactccctcaacgtcaggcttgcctaccctgttcatgcacagatgccctcgctttgcagataa
Sequence Length
1386
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,465 Da
NCBI Official Full Name
Homo sapiens phosphoinositide-3-kinase, regulatory subunit 3 (gamma), mRNA
NCBI Official Synonym Full Names
phosphoinositide-3-kinase regulatory subunit 3
NCBI Official Symbol
PIK3R3
NCBI Official Synonym Symbols
p55; p55PIK; p55-GAMMA
NCBI Protein Information
phosphatidylinositol 3-kinase regulatory subunit gamma
UniProt Protein Name
Phosphatidylinositol 3-kinase regulatory subunit gamma
UniProt Gene Name
PIK3R3
UniProt Synonym Gene Names
PI3-kinase regulatory subunit gamma; PI3K regulatory subunit gamma; PtdIns-3-kinase regulatory subunit gamma; PI3-kinase subunit p55-gamma; PtdIns-3-kinase regulatory subunit p55-gamma
UniProt Entry Name
P55G_HUMAN

NCBI Description

Phosphatidylinositol 3-kinase (PI3K) phosphorylates phosphatidylinositol and similar compounds, which then serve as second messengers in growth signaling pathways. PI3K is composed of a catalytic and a regulatory subunit. The protein encoded by this gene represents a regulatory subunit of PI3K. The encoded protein contains two SH2 domains through which it binds activated protein tyrosine kinases to regulate their activity. [provided by RefSeq, Jun 2016]

Uniprot Description

PIK3R3: Binds to activated (phosphorylated) protein-tyrosine kinases through its SH2 domain and regulates their kinase activity. During insulin stimulation, it also binds to IRS-1. Heterodimer of a regulatory subunit PIK3R3 and a p110 catalytic subunit (PIK3CA, PIK3CB or PIK3CD). Interacts with AXL. Highest levels in brain and testis. Lower levels in adipose tissue, kidney, heart, lung and skeletal muscle. Belongs to the PI3K p85 subunit family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, lipid; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 1p34.1

Cellular Component: cytosol; phosphoinositide 3-kinase complex

Molecular Function: 1-phosphatidylinositol-3-kinase activity; 1-phosphatidylinositol-3-kinase regulator activity; protein binding

Biological Process: phosphatidylinositol biosynthetic process; regulation of phosphoinositide 3-kinase activity

Research Articles on PIK3R3

Similar Products

Product Notes

The PIK3R3 pik3r3 (Catalog #AAA1267376) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacaata cggtgtggag tatggaccgc gatgacgcag actggaggga ggtgatgatg ccctattcga cagaactgat attttatatt gaaatggatc ctccagctct tccaccaaag ccacctaagc caatgacttc agcagttcca aatggaatga aggacagttc tgtttctctt caggatgcag aatggtactg gggggatatt tcaagggagg aggtaaatga caaattgcgg gatatgccag atgggacctt cttggtccga gatgcctcaa caaaaatgca gggagattat actttgactt tgcggaaggg aggcaataat aagttaataa agatctatca ccgggatggt aaatatggct tttctgatcc tctgacattt aattccgtgg tggagctcat taaccactat caccatgaat ctcttgctca gtacaatccc aaacttgatg tgaagctgat gtacccagtg tccagatacc aacaggatca gttggtaaaa gaagataata ttgatgcagt aggtaaaaaa ctgcaagaat accactctca gtatcaggag aagagtaaag agtatgatag gctgtatgaa gaatatacta gaacatccca ggaaatacag atgaagagga ctgcaataga agcttttaat gaaacaatta aaatatttga agagcagtgt cacacacaag aacaacatag caaagaatat attgagcgat ttcgcagaga ggggaatgaa aaggagattg aacgaattat gatgaattat gataaattga aatcacgtct gggtgagatt catgatagca aaatgcgtct agagcaggat ttgaagaatc aagctttgga caaccgagaa atagataaaa aaatgaatag catcaaacct gacctgatcc agctgcgaaa gatccgagat caacaccttg tatggctcaa tcacaaagga gtgagacaga aacgcctgaa tgtctggctg ggaattaaga atgaggatgc tgctgagaac tattttatca atgaggaaga tgaaaacctg ccccattatg atgagaaaac ctggtttgtt gaggatatca atcgagtaca agcagaggac ttgctttatg ggaaacctga tggtgcattc ttaattcgtg agagtagcaa gaaaggatgc tatgcttgct ctgtggtggc cgatggggaa gtgaagcact gtgtgatcta cagcactgct cggggctatg gctttgcaga gccctacaac ctgtacagct ctctgaagga gctagtgctc cattaccagc agacatcctt ggttcagcac aacgactccc tcaacgtcag gcttgcctac cctgttcatg cacagatgcc ctcgctttgc agataa. It is sometimes possible for the material contained within the vial of "PIK3R3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.