Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIGM cdna clone

PIGM cDNA Clone

Gene Names
PIGM; GPI-MT-I
Synonyms
PIGM; PIGM cDNA Clone; PIGM cdna clone
Ordering
For Research Use Only!
Sequence
atgggctccaccaagcactggggcgaatggctcctgaacttgaaggtggctccagccggcgtctttggtgtggcctttctagccagagtcgccctggttttctatggcgtcttccaggaccggaccctgcacgtgaggtatacggacatcgactaccaggtcttcaccgacgccgcgcgcttcgtcacggaggggcgctcgccttacctgagagccacgtaccgttacaccccgctgctgggttggctcctcactcccaacatctacctcagcgagctctttggaaagtttctcttcatcagctgcgacctcctcaccgctttcctcttataccgcctgctgctgctgaaggggctggggcgccgccaggcttgtggctactgtgtcttttggcttcttaaccccctgcctatggcagtatccagccgcggtaatgcggactctattgtcgcctccctggtcctgatggtcctctacttgataaagaaaagactcgtcgcgtgtgcagctgtattctatggtttcgcggtgcatatgaagatatatccagtgacttacatccttcccataaccctccacctgcttccagatcgcgacaatgacaaaagcctccgtcaattccggtacactttccaggcttgtttgtacgagctcctgaaaaggctgtgtaatcgggctgtgctgctgtttgtagcagttgctggactcacgttttttgccctgagctttggtttttactatgagtacggctgggaatttttggaacacacctacttttatcacctgactaggcgggatatccgtcacaacttttctccgtacttctacatgctgtatttgactgcagagagcaagtggagtttttccctgggaattgctgcattcctgccacagctcatcttgctttcagctgtgtctttcgcctattacagagacctcgttttttgttgttttcttcatacgtccatttttgtgacttttaacaaagtctgcacctcccagtactttctttggtacctctgcttactgcctcttgtgatgccactagtcagaatgccttggaaaagagctgtagttctcctaatgttatggtttatagggcaggccatgtggctggctcctgcctatgttctagagtttcaaggaaagaacacctttctgtttatttggttagctggtttgttctttcttcttatcaattgttccatcctgattcaaattatttcccattacaaagaagaacccctgacagagagaatcaaatatgactag
Sequence Length
1272
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,460 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class M, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol glycan anchor biosynthesis class M
NCBI Official Symbol
PIGM
NCBI Official Synonym Symbols
GPI-MT-I
NCBI Protein Information
GPI mannosyltransferase 1
UniProt Protein Name
GPI mannosyltransferase 1
UniProt Gene Name
PIGM
UniProt Synonym Gene Names
GPI-MT-I; PIG-M
UniProt Entry Name
PIGM_HUMAN

NCBI Description

This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI)-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes a mannosyltransferase, GPI-MT-I, that transfers the first mannose to GPI on the lumenal side of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]

Uniprot Description

PIGM: Mannosyltransferase involved in glycosylphosphatidylinositol-anchor biosynthesis. Transfers the first alpha-1,4-mannose to GlcN-acyl-PI during GPI precursor assembly. Defects in PIGM are the cause of glycosylphosphatidylinositol deficiency (GPID). GPID is an autosomal recessive trait that results in a propensity to venous thrombosis and seizures. Deficiency is due to a point mutation in the regulatory sequences of PIGM that disrupts binding of the transcription factor SP1 to its cognate promoter motif, leading to a strong reduction of expression. Belongs to the PIGM family.

Protein type: Membrane protein, integral; Glycan Metabolism - glycosylphosphatidylinositol (GPI)-anchor biosynthesis; EC 2.4.1.-; Membrane protein, multi-pass; Transferase

Chromosomal Location of Human Ortholog: 1q23.2

Cellular Component: endoplasmic reticulum membrane

Biological Process: preassembly of GPI anchor in ER membrane

Disease: Glycosylphosphatidylinositol Deficiency

Research Articles on PIGM

Similar Products

Product Notes

The PIGM pigm (Catalog #AAA1266404) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctcca ccaagcactg gggcgaatgg ctcctgaact tgaaggtggc tccagccggc gtctttggtg tggcctttct agccagagtc gccctggttt tctatggcgt cttccaggac cggaccctgc acgtgaggta tacggacatc gactaccagg tcttcaccga cgccgcgcgc ttcgtcacgg aggggcgctc gccttacctg agagccacgt accgttacac cccgctgctg ggttggctcc tcactcccaa catctacctc agcgagctct ttggaaagtt tctcttcatc agctgcgacc tcctcaccgc tttcctctta taccgcctgc tgctgctgaa ggggctgggg cgccgccagg cttgtggcta ctgtgtcttt tggcttctta accccctgcc tatggcagta tccagccgcg gtaatgcgga ctctattgtc gcctccctgg tcctgatggt cctctacttg ataaagaaaa gactcgtcgc gtgtgcagct gtattctatg gtttcgcggt gcatatgaag atatatccag tgacttacat ccttcccata accctccacc tgcttccaga tcgcgacaat gacaaaagcc tccgtcaatt ccggtacact ttccaggctt gtttgtacga gctcctgaaa aggctgtgta atcgggctgt gctgctgttt gtagcagttg ctggactcac gttttttgcc ctgagctttg gtttttacta tgagtacggc tgggaatttt tggaacacac ctacttttat cacctgacta ggcgggatat ccgtcacaac ttttctccgt acttctacat gctgtatttg actgcagaga gcaagtggag tttttccctg ggaattgctg cattcctgcc acagctcatc ttgctttcag ctgtgtcttt cgcctattac agagacctcg ttttttgttg ttttcttcat acgtccattt ttgtgacttt taacaaagtc tgcacctccc agtactttct ttggtacctc tgcttactgc ctcttgtgat gccactagtc agaatgcctt ggaaaagagc tgtagttctc ctaatgttat ggtttatagg gcaggccatg tggctggctc ctgcctatgt tctagagttt caaggaaaga acacctttct gtttatttgg ttagctggtt tgttctttct tcttatcaat tgttccatcc tgattcaaat tatttcccat tacaaagaag aacccctgac agagagaatc aaatatgact ag. It is sometimes possible for the material contained within the vial of "PIGM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.