Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIGK cdna clone

PIGK cDNA Clone

Gene Names
PIGK; GPI8
Synonyms
PIGK; PIGK cDNA Clone; PIGK cdna clone
Ordering
For Research Use Only!
Sequence
atggccgtcaccgacagcctcagccgggctgcgactgtcttggcaactgtgttgctcttgtccttcggcagcgtggccgctagtcatatcgaggatcaagcagaacaattctttagaagtggccatacaaacaactgggctgttctggtgtgtacatcccgattctggtttaattatcgacatgttgcaaataccctttctgtttatagaagtgtcaagaggctaggtattcctgacagtcacattgtcctaatgcttgcagatgatatggcctgtaatcctagaaatcccaaaccagctacagtgtttagtcacaagaatatggaactaaatgtgtatggagatgatgtggaagtggattatagaagttatgaggtaactgtggagaattttttacgggtattaactggggggatcccacctagtactcctcggtcaaaacgtcttctttctgatgacagaagcaatattctaatttatatgacagggcatggtggaaatggtttcttaaaatttcaagattctgaagaaattaccaacatagaactcgcggatgcttttgaacaaatgtggcagaaaagacgctacaatgagctactgtttattattgatacttgccaaggagcatccatgtatgaacgattttattctcctaacataatggctctagctagtagtcaagtgggagaagattcactctcgcatcaacctgatcctgcaattggagtccatcttatggatagatacacattttatgtcttggaatttttggaagaaattaacccagctagccaaactaatatgaatgacctttttcaggtatgtcccaaaagtctgtgtgtgtctactcctggacatcgcactgatctttttcagagggatcctaaaaatgtactgataactgatttctttggaagtgtacggaaagtggaaattacaacagagactattaaattgcaacaggattcagaaatcatggaaagcaggtattcatcttaa
Sequence Length
999
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,416 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class K, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol glycan anchor biosynthesis class K
NCBI Official Symbol
PIGK
NCBI Official Synonym Symbols
GPI8
NCBI Protein Information
GPI-anchor transamidase
UniProt Protein Name
GPI-anchor transamidase
UniProt Gene Name
PIGK
UniProt Synonym Gene Names
GPI8; GPI transamidase; hGPI8; PIG-K
UniProt Entry Name
GPI8_HUMAN

NCBI Description

This gene encodes a member of the cysteine protease family C13 that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is a member of the multisubunit enzyme, GPI transamidase and is thought to be its enzymatic component. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]

Uniprot Description

PIGK: Mediates GPI anchoring in the endoplasmic reticulum, by replacing a protein's C-terminal GPI attachment signal peptide with a pre-assembled GPI. During this transamidation reaction, the GPI transamidase forms a carbonyl intermediate with the substrate protein. Belongs to the peptidase C13 family.

Protein type: EC 3.-.-.-; Endoplasmic reticulum; Protease; Glycan Metabolism - glycosylphosphatidylinositol (GPI)-anchor biosynthesis; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p31.1

Cellular Component: endoplasmic reticulum membrane; GPI-anchor transamidase complex; membrane

Molecular Function: GPI-anchor transamidase activity; protein binding; protein disulfide isomerase activity

Biological Process: attachment of GPI anchor to protein

Research Articles on PIGK

Similar Products

Product Notes

The PIGK pigk (Catalog #AAA1275185) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgtca ccgacagcct cagccgggct gcgactgtct tggcaactgt gttgctcttg tccttcggca gcgtggccgc tagtcatatc gaggatcaag cagaacaatt ctttagaagt ggccatacaa acaactgggc tgttctggtg tgtacatccc gattctggtt taattatcga catgttgcaa ataccctttc tgtttataga agtgtcaaga ggctaggtat tcctgacagt cacattgtcc taatgcttgc agatgatatg gcctgtaatc ctagaaatcc caaaccagct acagtgttta gtcacaagaa tatggaacta aatgtgtatg gagatgatgt ggaagtggat tatagaagtt atgaggtaac tgtggagaat tttttacggg tattaactgg ggggatccca cctagtactc ctcggtcaaa acgtcttctt tctgatgaca gaagcaatat tctaatttat atgacagggc atggtggaaa tggtttctta aaatttcaag attctgaaga aattaccaac atagaactcg cggatgcttt tgaacaaatg tggcagaaaa gacgctacaa tgagctactg tttattattg atacttgcca aggagcatcc atgtatgaac gattttattc tcctaacata atggctctag ctagtagtca agtgggagaa gattcactct cgcatcaacc tgatcctgca attggagtcc atcttatgga tagatacaca ttttatgtct tggaattttt ggaagaaatt aacccagcta gccaaactaa tatgaatgac ctttttcagg tatgtcccaa aagtctgtgt gtgtctactc ctggacatcg cactgatctt tttcagaggg atcctaaaaa tgtactgata actgatttct ttggaagtgt acggaaagtg gaaattacaa cagagactat taaattgcaa caggattcag aaatcatgga aagcaggtat tcatcttaa. It is sometimes possible for the material contained within the vial of "PIGK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.