PHF1 cdna clone
PHF1 cDNA Clone
Gene Names
PHF1; PCL1; PHF2; hPHF1; MTF2L2; TDRD19C
Synonyms
PHF1; PHF1 cDNA Clone; PHF1 cdna clone
Sequence
atggcgcagcccccccggctgagccgctctggtgcctcctcactttgggacccagcttctcctgctcccacctctggccccaggcctcggctttgggagggtcaagatgtgctggccagatggactgatgggctgctatacttgggtaccatcaaaaaggtggacagtgctagggaggtgtgtctggtccagtttgaggatgattcgcagtttctggttctatggaaagacattagccctgctgccctccctggagaggaactcctctgttgtgtctgtcgctctgagactgtggtccctgggaaccggctggtcagctgtgagaagtgtcgccatgcttatcaccaggactgccatgttcccagggctccagcccctggagagggagagggcacatcctgggtatgccgccagtgtgtctttgcgatcgccaccaagaggggaggtgccctgaagaagggcccctatgcccgggccatgctgggtatgaagctttctctgccatatggactgaaggggctggactgggatgctggacatctgagcaaccgacagcagagttactgttactgtggtggccctggggagtggaacctgaaaatgctgcagtgccggagctgcctgcagtggttccatgaggcctgcacccagtgtctgagcaagcccctcctctatggggacaggttctatgaatttgaatgctgtgtgtgtcgcgggggccctgagaaagtccggagactacagcttcgctgggtggatgtggcccatcttgtcctgtatcacctcagtgtttgctgtaagaagaaatactttgattttgatcgtgagatcctccccttcacttctgagaattgggacagtttgctcctgggggagctttcagacacccccaaaggagaacgttcttccaagctcctctctgctcttaacagccacaaggaccgtttcatttcagggagagagattaagaagaggaaatgtttgtttggtctccatgctcggatgcctccccctgtggagccccctactggagatggagcactcaccagcttcccttcagggcagggccctgggggaggggtctcacgtcccctggggaagcgccggaggccggagccagagcccctgaggaggaggcagaaggggaaagtggaggagctggggccaccctcagcagtgcgcaatcagcccgagccccaggagcagagggagcgggctcatctgcagagggcactgcaggcctcagtgtctccaccatcccccagccctaaccagagttaccagggcagcagcggctacaacttccggcccacagatgcccgctgcctgcccagcagccccatccggatgtttgcttccttccacccttctgccagcaccgcagggacctctggggacagtggacccccagacaggtcacccctggaacttcacattggtttccccacagacatccctaaaagtgccccccactcgatgactgcctcatcttcctcagtttcatccccatccccaggtcttcctagacgctcagcacccccttctcccctgtgccgtagtttgtctcctgggactgggggaggagtccgaggtggggttggttacctgtcccgaggggaccctgtccgggtccttgctcggagagtacggcctgatggctctgtgcagtacctggttgagtggggaggagggggcatcttctga
Sequence Length
1704
Vector
pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,643 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 1, mRNA
NCBI Official Synonym Full Names
PHD finger protein 1
NCBI Official Symbol
PHF1
NCBI Official Synonym Symbols
PCL1; PHF2; hPHF1; MTF2L2; TDRD19C
NCBI Protein Information
PHD finger protein 1
UniProt Protein Name
PHD finger protein 1
Protein Family
UniProt Gene Name
PHF1
UniProt Synonym Gene Names
PCL1; Protein PHF1; hPHF1; hPCl1
UniProt Entry Name
PHF1_HUMAN
NCBI Description
This gene encodes a Polycomb group protein. The protein is a component of a histone H3 lysine-27 (H3K27)-specific methyltransferase complex, and functions in transcriptional repression of homeotic genes. The protein is also recruited to double-strand breaks, and reduced protein levels results in X-ray sensitivity and increased homologous recombination. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Uniprot Description
PHF1: Transcriptional repressor. May promote methylation of histone H3 on 'Lys-27' by the PRC2/EED-EZH2 complex. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription factor
Chromosomal Location of Human Ortholog: 6p21.3
Cellular Component: ESC/E(Z) complex; nucleoplasm; nucleus
Molecular Function: methylated histone residue binding; protein binding; transcription factor activity
Biological Process: negative regulation of gene expression, epigenetic; response to DNA damage stimulus
Research Articles on PHF1
Similar Products
Product Notes
The PHF1 phf1 (Catalog #AAA1266729) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcagc ccccccggct gagccgctct ggtgcctcct cactttggga cccagcttct cctgctccca cctctggccc caggcctcgg ctttgggagg gtcaagatgt gctggccaga tggactgatg ggctgctata cttgggtacc atcaaaaagg tggacagtgc tagggaggtg tgtctggtcc agtttgagga tgattcgcag tttctggttc tatggaaaga cattagccct gctgccctcc ctggagagga actcctctgt tgtgtctgtc gctctgagac tgtggtccct gggaaccggc tggtcagctg tgagaagtgt cgccatgctt atcaccagga ctgccatgtt cccagggctc cagcccctgg agagggagag ggcacatcct gggtatgccg ccagtgtgtc tttgcgatcg ccaccaagag gggaggtgcc ctgaagaagg gcccctatgc ccgggccatg ctgggtatga agctttctct gccatatgga ctgaaggggc tggactggga tgctggacat ctgagcaacc gacagcagag ttactgttac tgtggtggcc ctggggagtg gaacctgaaa atgctgcagt gccggagctg cctgcagtgg ttccatgagg cctgcaccca gtgtctgagc aagcccctcc tctatgggga caggttctat gaatttgaat gctgtgtgtg tcgcgggggc cctgagaaag tccggagact acagcttcgc tgggtggatg tggcccatct tgtcctgtat cacctcagtg tttgctgtaa gaagaaatac tttgattttg atcgtgagat cctccccttc acttctgaga attgggacag tttgctcctg ggggagcttt cagacacccc caaaggagaa cgttcttcca agctcctctc tgctcttaac agccacaagg accgtttcat ttcagggaga gagattaaga agaggaaatg tttgtttggt ctccatgctc ggatgcctcc ccctgtggag ccccctactg gagatggagc actcaccagc ttcccttcag ggcagggccc tgggggaggg gtctcacgtc ccctggggaa gcgccggagg ccggagccag agcccctgag gaggaggcag aaggggaaag tggaggagct ggggccaccc tcagcagtgc gcaatcagcc cgagccccag gagcagaggg agcgggctca tctgcagagg gcactgcagg cctcagtgtc tccaccatcc cccagcccta accagagtta ccagggcagc agcggctaca acttccggcc cacagatgcc cgctgcctgc ccagcagccc catccggatg tttgcttcct tccacccttc tgccagcacc gcagggacct ctggggacag tggaccccca gacaggtcac ccctggaact tcacattggt ttccccacag acatccctaa aagtgccccc cactcgatga ctgcctcatc ttcctcagtt tcatccccat ccccaggtct tcctagacgc tcagcacccc cttctcccct gtgccgtagt ttgtctcctg ggactggggg aggagtccga ggtggggttg gttacctgtc ccgaggggac cctgtccggg tccttgctcg gagagtacgg cctgatggct ctgtgcagta cctggttgag tggggaggag ggggcatctt ctga. It is sometimes possible for the material contained within the vial of "PHF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
