Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHC2 cdna clone

PHC2 cDNA Clone

Gene Names
PHC2; PH2; EDR2; HPH2
Synonyms
PHC2; PHC2 cDNA Clone; PHC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgacctcagggaacggaaactctgcctccagcatcgccggcactgccccccagaatggtgagaataaaccaccacaggccattgtgaaaccccaaatcctgacgcatgttatcgaagggtttgtgatccaggagggggcggagcctttcccggtgggacgctcgtccctgctggtggggaatctcaagaagaagtatgcacaggggttcctgcctgagaaacttccacagcaggatcacaccaccaccactgactcggagatggaggagccctatctgcaagaatccaaagaggagggtgctcccctcaaactcaagtgtgagctctgtggccgggtggactttgcctataagttcaagcgttccaagcgcttctgttccatggcttgtgcaaagaggtacaacgtgggatgcaccaaacgggtgggacttttccactcagaccggagcaagctgcagaaggcaggagctgcgacccacaaccgccgtcgggccagcaaagccagtctgccaccacttaccaaggataccaagaagcagccaacaggcactgtgcccctttcggttactgctgctttgcagctaacacacagccaggaagactccagccgttgctcagataactcaagctatgaggaacccttgtcacccatctcagccagctcatctacttcccgccggcgacaaggccagcgggacctggagctccccgacatgcatatgcgggacctggtgggcatgggacaccacttcctgccaagtgagcccaccaagtggaatgtagaagacgtctacgaattcatccgctctctgccaggctgccaggagatagcagaggaattccgtgcccaggaaatcgacgggcaagccctgctgctgctcaaggaggaccacctgatgagcgccatgaacatcaagctggggcccgccctgaagatctacgcccgcatcagcatgctcaaggactcctag
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,812 Da
NCBI Official Full Name
Homo sapiens polyhomeotic homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
polyhomeotic homolog 2
NCBI Official Symbol
PHC2
NCBI Official Synonym Symbols
PH2; EDR2; HPH2
NCBI Protein Information
polyhomeotic-like protein 2
UniProt Protein Name
Polyhomeotic-like protein 2
Protein Family
UniProt Gene Name
PHC2
UniProt Synonym Gene Names
EDR2; PH2; hPH2
UniProt Entry Name
PHC2_HUMAN

NCBI Description

In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

PHC2: Component of a Polycomb group (PcG) multiprotein PRC1- like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 1p34.3

Cellular Component: nucleoplasm; nucleus; PcG protein complex

Molecular Function: identical protein binding; protein binding

Biological Process: protein sumoylation

Research Articles on PHC2

Similar Products

Product Notes

The PHC2 phc2 (Catalog #AAA1276997) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctcag ggaacggaaa ctctgcctcc agcatcgccg gcactgcccc ccagaatggt gagaataaac caccacaggc cattgtgaaa ccccaaatcc tgacgcatgt tatcgaaggg tttgtgatcc aggagggggc ggagcctttc ccggtgggac gctcgtccct gctggtgggg aatctcaaga agaagtatgc acaggggttc ctgcctgaga aacttccaca gcaggatcac accaccacca ctgactcgga gatggaggag ccctatctgc aagaatccaa agaggagggt gctcccctca aactcaagtg tgagctctgt ggccgggtgg actttgccta taagttcaag cgttccaagc gcttctgttc catggcttgt gcaaagaggt acaacgtggg atgcaccaaa cgggtgggac ttttccactc agaccggagc aagctgcaga aggcaggagc tgcgacccac aaccgccgtc gggccagcaa agccagtctg ccaccactta ccaaggatac caagaagcag ccaacaggca ctgtgcccct ttcggttact gctgctttgc agctaacaca cagccaggaa gactccagcc gttgctcaga taactcaagc tatgaggaac ccttgtcacc catctcagcc agctcatcta cttcccgccg gcgacaaggc cagcgggacc tggagctccc cgacatgcat atgcgggacc tggtgggcat gggacaccac ttcctgccaa gtgagcccac caagtggaat gtagaagacg tctacgaatt catccgctct ctgccaggct gccaggagat agcagaggaa ttccgtgccc aggaaatcga cgggcaagcc ctgctgctgc tcaaggagga ccacctgatg agcgccatga acatcaagct ggggcccgcc ctgaagatct acgcccgcat cagcatgctc aaggactcct ag. It is sometimes possible for the material contained within the vial of "PHC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.