PGM3 cdna clone
PGM3 cDNA Clone
Gene Names
PGM3; AGM1; PAGM; IMD23; PGM 3
Synonyms
PGM3; PGM3 cDNA Clone; PGM3 cdna clone
Sequence
atggatttaggtgctattacaaaatactcagcattacacgccaagcccaatggactgatccttcaatacgggactgctggatttcgaacgaaggcagaacatcttgatcatgtcatgtttcgcatgggattattagctgtcctgaggtcaaaacagacaaaatccactataggagtcatggtaacagcgtcccacaatcctgaggaagacaatggtgtaaaattggttgatcctttgggtgaaatgttggcaccatcctgggaggaacatgccacctgtttagcaaatgctgaggaacaagatatgcagagagtgcttattgacatcagcgagaaagaagctgtgaatctgcaacaagatgcctttgtagttattggtagagataccaggcccagcagtgagaaactttcacaatctgtaatagatggtgtgactgttctaggaggtcaattccatgattatggcttgttaacaacaccccagctgcactacatggtgtattgtcgaaacacgggtggccgatatggaaaggcaactatagaaggttactaccagaaactctctaaggcttttgtggaactcaccaaacaggcttcttgcagtggagatgaatacagatcacttaaggttgactgtgcaaatggcataggggccctgaagctaagggaaatggaacactacttctcacagggcctgtcagttcagctgtttaatgatgggtccaagggcaaactcaatcatttatgtggagctgactttgtgaaaagtcatcagaaacctccacagggaatggaaattaagtccaatgaaagatgctgttcttttgatggagatgcagacagaattgtttattactaccatgatgcagatggccactttcatctcatagatggagacaagatagcaacgttaattagcagtttccttaaagagctcctggtggagattggagaaagtttgaatattggtgttgtacaaactgcatatgcaaatggaagttcaacacggtatcttgaagaagttatgaaggtacctgtctattgcactaagactggtgtaaaacatttgcaccacaaggctcaagagtttgacattggagtttattttgaagcaaatgggcatggcactgcactgtttagtacagctgttgaaatgaagataaaacaatcagcagaacaactggaagataagaaaagaaaagctgctaagatgcttgaaaacattattgacttgtttaaccaggcagctggtgatgctatttctgacatgctggtgattgaggcaatcttggctctgaagggcttgactgtacaacagtgggatgctctctatacagatcttccaaacagacaacttaaagttcaggttgcagacaggagagttattagcactaccaatgctgaaagacaagcagttacacccccaggattacaggaggcaatcaatgacctggtgaagaagtacaagctttctcgagcttttgtccggccctctggtacagaagatgtcgtccgagtatatgcagaagcagactcacaagaaagtgcagatcaccttgcacatgaagtgagcttggcagtatttcagctggctggaggaattggagaaaggccccaaccaggtttctga
Sequence Length
1629
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
62,941 Da
NCBI Official Full Name
Homo sapiens phosphoglucomutase 3, mRNA
NCBI Official Synonym Full Names
phosphoglucomutase 3
NCBI Official Symbol
PGM3
NCBI Official Synonym Symbols
AGM1; PAGM; IMD23; PGM 3
NCBI Protein Information
phosphoacetylglucosamine mutase
UniProt Protein Name
Phosphoacetylglucosamine mutase
UniProt Gene Name
PGM3
UniProt Synonym Gene Names
PGM 3
UniProt Entry Name
AGM1_HUMAN
NCBI Description
This gene encodes a member of the phosphohexose mutase family. The encoded protein mediates both glycogen formation and utilization by catalyzing the interconversion of glucose-1-phosphate and glucose-6-phosphate. A non-synonymous single nucleotide polymorphism in this gene may play a role in resistance to diabetic nephropathy and neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Uniprot Description
PGM3: Interconverts GlcNAc-6-P and GlcNAc-1-P. Belongs to the phosphohexose mutase family.
Protein type: EC 5.4.2.3; Isomerase; Carbohydrate Metabolism - amino sugar and nucleotide sugar
Chromosomal Location of Human Ortholog: 6q14.1-q15
Cellular Component: cytosol
Molecular Function: phosphoacetylglucosamine mutase activity
Biological Process: hemopoiesis; protein amino acid N-linked glycosylation; protein amino acid O-linked glycosylation; UDP-N-acetylglucosamine biosynthetic process
Disease: Immunodeficiency 23
Research Articles on PGM3
Similar Products
Product Notes
The PGM3 pgm3 (Catalog #AAA1278432) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatttag gtgctattac aaaatactca gcattacacg ccaagcccaa tggactgatc cttcaatacg ggactgctgg atttcgaacg aaggcagaac atcttgatca tgtcatgttt cgcatgggat tattagctgt cctgaggtca aaacagacaa aatccactat aggagtcatg gtaacagcgt cccacaatcc tgaggaagac aatggtgtaa aattggttga tcctttgggt gaaatgttgg caccatcctg ggaggaacat gccacctgtt tagcaaatgc tgaggaacaa gatatgcaga gagtgcttat tgacatcagc gagaaagaag ctgtgaatct gcaacaagat gcctttgtag ttattggtag agataccagg cccagcagtg agaaactttc acaatctgta atagatggtg tgactgttct aggaggtcaa ttccatgatt atggcttgtt aacaacaccc cagctgcact acatggtgta ttgtcgaaac acgggtggcc gatatggaaa ggcaactata gaaggttact accagaaact ctctaaggct tttgtggaac tcaccaaaca ggcttcttgc agtggagatg aatacagatc acttaaggtt gactgtgcaa atggcatagg ggccctgaag ctaagggaaa tggaacacta cttctcacag ggcctgtcag ttcagctgtt taatgatggg tccaagggca aactcaatca tttatgtgga gctgactttg tgaaaagtca tcagaaacct ccacagggaa tggaaattaa gtccaatgaa agatgctgtt cttttgatgg agatgcagac agaattgttt attactacca tgatgcagat ggccactttc atctcataga tggagacaag atagcaacgt taattagcag tttccttaaa gagctcctgg tggagattgg agaaagtttg aatattggtg ttgtacaaac tgcatatgca aatggaagtt caacacggta tcttgaagaa gttatgaagg tacctgtcta ttgcactaag actggtgtaa aacatttgca ccacaaggct caagagtttg acattggagt ttattttgaa gcaaatgggc atggcactgc actgtttagt acagctgttg aaatgaagat aaaacaatca gcagaacaac tggaagataa gaaaagaaaa gctgctaaga tgcttgaaaa cattattgac ttgtttaacc aggcagctgg tgatgctatt tctgacatgc tggtgattga ggcaatcttg gctctgaagg gcttgactgt acaacagtgg gatgctctct atacagatct tccaaacaga caacttaaag ttcaggttgc agacaggaga gttattagca ctaccaatgc tgaaagacaa gcagttacac ccccaggatt acaggaggca atcaatgacc tggtgaagaa gtacaagctt tctcgagctt ttgtccggcc ctctggtaca gaagatgtcg tccgagtata tgcagaagca gactcacaag aaagtgcaga tcaccttgca catgaagtga gcttggcagt atttcagctg gctggaggaa ttggagaaag gccccaacca ggtttctga. It is sometimes possible for the material contained within the vial of "PGM3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
