Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PFKL cdna clone

PFKL cDNA Clone

Gene Names
PFKL; PFK-B; PFK-L; ATP-PFK
Synonyms
PFKL; PFKL cDNA Clone; PFKL cdna clone
Ordering
For Research Use Only!
Sequence
atggccgcggtggacctggagaagctgcgggcgtcgggcgcgggcaaggccatcggcgtcctgaccagcggcggcgacgcgcaaggcatgaacgctgctgtccgggctgtgacgcgcatgggcatttatgtgggtgccaaagtcttcctcatctacgagggctatgagggcctcgtggagggaggtgagaacatcaagcaggccaactggctgagcgtctccaacatcatccagctgggcggcactatcattggcagcgctcgctgcaaggcctttaccaccagggaggggcgccgggcagcggcctacaacctggtccagcacggcatcaccaacctgtgcgtcatcggcggggatggcagccttacaggtgccaacatcttccgcagcgagtggggcagcctgctggaggagctggtggcggaaggtaagatctcagagactacagcccggacctactcgcacctgaacatcgcgggcctagtgggctccatcgataacgacttctgcggcaccgacatgaccatcggcacggactcggccctccaccgcatcatggaggtcatcgatgccatcaccaccactgcccagagccaccagaggaccttcgtgctggaagtgatgggccggcactgcgggtacctggcgctggtatctgcactggcctcaggggccgactggctgttcatccccgaggctccacccgaggacggctgggagaacttcatgtgtgagaggctgggtgagactcggagccgtgggtcccgactgaacatcatcatcatcgctgagggtgccattgaccgcaacgggaagcccatctcgtccagctacgtgaaggacctggtggttcagaggctgggcttcgacacccgtgtaactgtgctgggccacgtgcagcggggagggacgccctctgccttcgaccggatcctgagcagcaagatgggcatggaggcggtgatggcgctgctggaagccacgcctgacacgccggcctgcgtggtcaccctctcggggaaccagtcagtgcggctgcccctcatggagtgcgtgcagatgaccaaggaagtgcagaaagccatggatgacaagaggtttgacgaggccacccagctccgtggtgggagcttcgagaacaactggaacatttacaagctcctcgcccaccagaagccccccaaggagaagtctaacttctccctggccatcctgaatgtgggggccccggcggctggcatgaatgcggccgtgcgctcggcggtgcggaccggcatctcccatggacacacagtatacgtggtgcacgatggcttcgaaggcctagccaagggtcaggtgcaagaagtaggctggcacgacgtggccggctggttggggcgtggtggctccatgctggggaccaagaggaccctgcccaagggccagctggagtccattgtggagaacatccgcatctatggtattcacgccctgctggtggtcggtgggtttgaggcctatgaaggggtgctgcagctggtggaggctcgcgggcgctacgaggagctctgcatcgtcatgtgtgtcatcccagccaccatcagcaacaacgtccctggcaccgacttcagcctgggctccgacactgctgtaaatgccgccatggagagctgtgaccgcatcaaacagtctgcctcggggaccaagcgccgtgtgttcatcgtggagaccatggggggttactgtggctacctggccaccgtgactggcattgctgtgggggccgacgccgcctacgtcttcgaggaccctttcaacatccacgacttaaaggtcaacgtggagcacatgacggagaagatgaagacagacattcagaggggcctggtgctgcggaacgagaagtgccatgactactacaccacggagttcctgtacaacctgtactcatcagagggcaacggcgtcttcgactgcaggaccaatgtcctgggccacctgcagcagggtggcgctccaaccccctttgaccggaactatgggaccaagctgggggtgaaggccatgctgtggttgtcggagaagctgcgcgaggtttaccgcaagggacgggtgttcgccaatgccccagactcggcctgcgtgatcggcctgaagaagaaggcggcggccttcagccccgtcactgagctcaagaaagacactgatttcgagcaccgcatgccacgggagcagtggtggctgagcctgcggctcatgctgaagatgctggcacaataccgcatcagtatggccgcctacgtgtcaggggagctggagcacgtgacccgccgcaccctgagcatggacaagggcttctga
Sequence Length
2343
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,203 Da
NCBI Official Full Name
Homo sapiens phosphofructokinase, liver, mRNA
NCBI Official Synonym Full Names
phosphofructokinase, liver type
NCBI Official Symbol
PFKL
NCBI Official Synonym Symbols
PFK-B; PFK-L; ATP-PFK
NCBI Protein Information
ATP-dependent 6-phosphofructokinase, liver type
UniProt Protein Name
ATP-dependent 6-phosphofructokinase, liver type
UniProt Gene Name
PFKL
UniProt Synonym Gene Names
ATP-PFK; PFK-L
UniProt Entry Name
PFKAL_HUMAN

NCBI Description

This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Uniprot Description

PFKL: phosphofructokinase, liver type. An ubiquitous metabolic enzyme involved in the synthesis and degradation of fructose 2,6-bisphosphate. Key control step of glycolysis. An allosteric enzyme activated by ADP, AMP, or fructose bisphosphate and inhibited by ATP or citrate. Activity: ATP D-fructose 6-phosphate = ADP D-fructose 1,6-bisphosphate. The holoenzyme consists of 4 subunits. The liver and muscle enzymes are homo-tetramers of four liver or muscle isoforms, respectively. The red blood cell enzyme consists hetero-tetramers of the muscle and liver isoforms. A subunit composition with a higher proportion of platelet type subunits is found in platelets, brain and fibroblasts. Two alternatively spliced isoforms have been described.

Protein type: EC 2.7.1.11; Carbohydrate Metabolism - fructose and mannose; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Carbohydrate Metabolism - galactose; Carbohydrate Metabolism - pentose phosphate pathway; Kinase, other

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: 6-phosphofructokinase complex; cytosol; membrane

Molecular Function: 6-phosphofructokinase activity; ATP binding; identical protein binding; kinase binding; protein binding

Biological Process: fructose 1,6-bisphosphate metabolic process; fructose 6-phosphate metabolic process; glycolysis; protein oligomerization; response to glucose stimulus

Research Articles on PFKL

Similar Products

Product Notes

The PFKL pfkl (Catalog #AAA1274644) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcgg tggacctgga gaagctgcgg gcgtcgggcg cgggcaaggc catcggcgtc ctgaccagcg gcggcgacgc gcaaggcatg aacgctgctg tccgggctgt gacgcgcatg ggcatttatg tgggtgccaa agtcttcctc atctacgagg gctatgaggg cctcgtggag ggaggtgaga acatcaagca ggccaactgg ctgagcgtct ccaacatcat ccagctgggc ggcactatca ttggcagcgc tcgctgcaag gcctttacca ccagggaggg gcgccgggca gcggcctaca acctggtcca gcacggcatc accaacctgt gcgtcatcgg cggggatggc agccttacag gtgccaacat cttccgcagc gagtggggca gcctgctgga ggagctggtg gcggaaggta agatctcaga gactacagcc cggacctact cgcacctgaa catcgcgggc ctagtgggct ccatcgataa cgacttctgc ggcaccgaca tgaccatcgg cacggactcg gccctccacc gcatcatgga ggtcatcgat gccatcacca ccactgccca gagccaccag aggaccttcg tgctggaagt gatgggccgg cactgcgggt acctggcgct ggtatctgca ctggcctcag gggccgactg gctgttcatc cccgaggctc cacccgagga cggctgggag aacttcatgt gtgagaggct gggtgagact cggagccgtg ggtcccgact gaacatcatc atcatcgctg agggtgccat tgaccgcaac gggaagccca tctcgtccag ctacgtgaag gacctggtgg ttcagaggct gggcttcgac acccgtgtaa ctgtgctggg ccacgtgcag cggggaggga cgccctctgc cttcgaccgg atcctgagca gcaagatggg catggaggcg gtgatggcgc tgctggaagc cacgcctgac acgccggcct gcgtggtcac cctctcgggg aaccagtcag tgcggctgcc cctcatggag tgcgtgcaga tgaccaagga agtgcagaaa gccatggatg acaagaggtt tgacgaggcc acccagctcc gtggtgggag cttcgagaac aactggaaca tttacaagct cctcgcccac cagaagcccc ccaaggagaa gtctaacttc tccctggcca tcctgaatgt gggggccccg gcggctggca tgaatgcggc cgtgcgctcg gcggtgcgga ccggcatctc ccatggacac acagtatacg tggtgcacga tggcttcgaa ggcctagcca agggtcaggt gcaagaagta ggctggcacg acgtggccgg ctggttgggg cgtggtggct ccatgctggg gaccaagagg accctgccca agggccagct ggagtccatt gtggagaaca tccgcatcta tggtattcac gccctgctgg tggtcggtgg gtttgaggcc tatgaagggg tgctgcagct ggtggaggct cgcgggcgct acgaggagct ctgcatcgtc atgtgtgtca tcccagccac catcagcaac aacgtccctg gcaccgactt cagcctgggc tccgacactg ctgtaaatgc cgccatggag agctgtgacc gcatcaaaca gtctgcctcg gggaccaagc gccgtgtgtt catcgtggag accatggggg gttactgtgg ctacctggcc accgtgactg gcattgctgt gggggccgac gccgcctacg tcttcgagga ccctttcaac atccacgact taaaggtcaa cgtggagcac atgacggaga agatgaagac agacattcag aggggcctgg tgctgcggaa cgagaagtgc catgactact acaccacgga gttcctgtac aacctgtact catcagaggg caacggcgtc ttcgactgca ggaccaatgt cctgggccac ctgcagcagg gtggcgctcc aacccccttt gaccggaact atgggaccaa gctgggggtg aaggccatgc tgtggttgtc ggagaagctg cgcgaggttt accgcaaggg acgggtgttc gccaatgccc cagactcggc ctgcgtgatc ggcctgaaga agaaggcggc ggccttcagc cccgtcactg agctcaagaa agacactgat ttcgagcacc gcatgccacg ggagcagtgg tggctgagcc tgcggctcat gctgaagatg ctggcacaat accgcatcag tatggccgcc tacgtgtcag gggagctgga gcacgtgacc cgccgcaccc tgagcatgga caagggcttc tga. It is sometimes possible for the material contained within the vial of "PFKL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.