Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PFKFB3 cdna clone

PFKFB3 cDNA Clone

Gene Names
PFKFB3; PFK2; IPFK2; iPFK-2
Synonyms
PFKFB3; PFKFB3 cDNA Clone; PFKFB3 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgttggaactgacgcagagccgagtgcagaagatctgggtgcccgtggaccacaggccctcgttgcccagatcctgtgggccaaagctgaccaactcccccaccgtcatcgtcatggtgggcctccccgcccggggcaagacctacatctccaagaagctgactcgctacctcaactggattggcgtccccacaaaagtgttcaacgtcggggagtatcgccgggaggctgtgaagcagtacagctcctacaacttcttccgccccgacaatgaggaagccatgaaagtccggaagcaatgtgccttagctgccttgagagatgtcaaaagctacctggcgaaagaagggggacaaattgcggttttcgatgccaccaatactactagagagaggagacacatgatccttcattttgccaaagaaaatgactttaaggcgtttttcatcgagtcggtgtgcgacgaccctacagttgtggcctccaatatcatggaagttaaaatctccagcccggattacaaagactgcaactcggcagaagccatggacgacttcatgaagaggatcagttgctatgaagccagctaccagcccctcgaccccgacaaatgcgacagggacttgtcgctgatcaaggtgattgacgtgggccggaggttcctggtgaaccgggtgcaggaccacatccagagccgcatcgtgtactacctgatgaacatccacgtgcagccgcgtaccatctacctgtgccggcacggcgagaacgagcacaacctccagggccgcatcgggggcgactcaggcctgtccagccggggcaagaagtttgccagtgctctgagcaagttcgtggaggagcagaacctgaaggacctgcgcgtgtggaccagccagctgaagagcaccatccagacggccgaggcgctgcggctgccctacgagcagtggaaggcgctcaatgagatcgacgcgggcgtctgtgaggagctgacctacgaggagatcagggacacctaccctgaggagtatgcgctgcgggagcaggacaagtactattaccgctaccccaccggggagtcctaccaggacctggtccagcgcttggagccagtgatcatggagctggagcggcaggagaatgtgctggtcatctgccaccaggccgtcctgcgctgcctgcttgcctacttcctggataagagtgcagaggagatgccctacctgaaatgccctcttcacaccgtcctgaaactgacgcctgtcgcttatggctgccgtgtggaatccatctacctgaacgtggagtccgtctgcacacaccgggagaggtcagaggatgcaaagaagggacctaacccgctcatgagacgcaatagtgtcaccccgctagccagccccgaacccaccaaaaagcctcgcatcaacagctttgaggagcatgtggcctccacctcggccgccctgcccagctgcctgcccccggaggtgcccacgcagctgcctggacaaaacatgaaaggctcccggagcagcgctgactcctccaggaaacactga
Sequence Length
1563
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,602 Da
NCBI Official Full Name
Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3, mRNA
NCBI Official Synonym Full Names
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
NCBI Official Symbol
PFKFB3
NCBI Official Synonym Symbols
PFK2; IPFK2; iPFK-2
NCBI Protein Information
6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3
UniProt Protein Name
6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3
UniProt Gene Name
PFKFB3
UniProt Synonym Gene Names
6PF-2-K/Fru-2,6-P2ase 3; PFK/FBPase 3
UniProt Entry Name
F263_HUMAN

NCBI Description

The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]

Uniprot Description

PFKFB3: Synthesis and degradation of fructose 2,6-bisphosphate. Ubiquitous. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Phosphatase (non-protein); Kinase, other; EC 2.7.1.105; EC 3.1.3.46; Carbohydrate Metabolism - fructose and mannose

Chromosomal Location of Human Ortholog: 10p15.1

Cellular Component: cytosol; nucleoplasm

Molecular Function: 6-phosphofructo-2-kinase activity

Research Articles on PFKFB3

Similar Products

Product Notes

The PFKFB3 pfkfb3 (Catalog #AAA1270434) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgttgg aactgacgca gagccgagtg cagaagatct gggtgcccgt ggaccacagg ccctcgttgc ccagatcctg tgggccaaag ctgaccaact cccccaccgt catcgtcatg gtgggcctcc ccgcccgggg caagacctac atctccaaga agctgactcg ctacctcaac tggattggcg tccccacaaa agtgttcaac gtcggggagt atcgccggga ggctgtgaag cagtacagct cctacaactt cttccgcccc gacaatgagg aagccatgaa agtccggaag caatgtgcct tagctgcctt gagagatgtc aaaagctacc tggcgaaaga agggggacaa attgcggttt tcgatgccac caatactact agagagagga gacacatgat ccttcatttt gccaaagaaa atgactttaa ggcgtttttc atcgagtcgg tgtgcgacga ccctacagtt gtggcctcca atatcatgga agttaaaatc tccagcccgg attacaaaga ctgcaactcg gcagaagcca tggacgactt catgaagagg atcagttgct atgaagccag ctaccagccc ctcgaccccg acaaatgcga cagggacttg tcgctgatca aggtgattga cgtgggccgg aggttcctgg tgaaccgggt gcaggaccac atccagagcc gcatcgtgta ctacctgatg aacatccacg tgcagccgcg taccatctac ctgtgccggc acggcgagaa cgagcacaac ctccagggcc gcatcggggg cgactcaggc ctgtccagcc ggggcaagaa gtttgccagt gctctgagca agttcgtgga ggagcagaac ctgaaggacc tgcgcgtgtg gaccagccag ctgaagagca ccatccagac ggccgaggcg ctgcggctgc cctacgagca gtggaaggcg ctcaatgaga tcgacgcggg cgtctgtgag gagctgacct acgaggagat cagggacacc taccctgagg agtatgcgct gcgggagcag gacaagtact attaccgcta ccccaccggg gagtcctacc aggacctggt ccagcgcttg gagccagtga tcatggagct ggagcggcag gagaatgtgc tggtcatctg ccaccaggcc gtcctgcgct gcctgcttgc ctacttcctg gataagagtg cagaggagat gccctacctg aaatgccctc ttcacaccgt cctgaaactg acgcctgtcg cttatggctg ccgtgtggaa tccatctacc tgaacgtgga gtccgtctgc acacaccggg agaggtcaga ggatgcaaag aagggaccta acccgctcat gagacgcaat agtgtcaccc cgctagccag ccccgaaccc accaaaaagc ctcgcatcaa cagctttgag gagcatgtgg cctccacctc ggccgccctg cccagctgcc tgcccccgga ggtgcccacg cagctgcctg gacaaaacat gaaaggctcc cggagcagcg ctgactcctc caggaaacac tga. It is sometimes possible for the material contained within the vial of "PFKFB3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.