Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PEX5 cdna clone

PEX5 cDNA Clone

Gene Names
PEX5; PXR1; PBD2A; PBD2B; PTS1R; RCDP5; PTS1-BP
Synonyms
PEX5; PEX5 cDNA Clone; PEX5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaatgcgggagctggtggaggccgaatgcgggggtgccaacccgctcatgaagctcgccgggcacttcacccaggacaaggcccttcggcaggagggattgaggcctggcccctggccccccggagccccggcctctgaggcagcctccaagcctttgggagtagcttctgaagatgagttggtggctgaattcctgcaggaccagaatgcaccccttgtgtcccgtgcccctcagaccttcaagatggatgacctcctggctgagatgcagcagattgagcagtcaaacttccgccaggctccccagagagcccctggtgtggcagacttggccttgtctgagaactgggcccaggagtttcttgcagctggagatgctgtggatgtaactcaggattataatgagactgactggtcccaagaattcatctctgaagttacagaccccttgtctgtgtcccctgcccgctgggctgaggaatatttggagcaatcagaggagaagctgtggctgggagaacctgagggaacagccaccgatcgctggtatgatgaatatcatcctgaggaggatctgcagcacacggccagtgactttgtggccaaagtggatgaccccaaattggctaattctgagttcctgaaattcgtgcggcagattggcgaagggcaggtgtccctggagtccggtgcagggtcgggccgagctcaggcagaacagtgggcagcagagtttatacagcagcagggtacatcagatgcctgggttgaccagttcacaagaccagtaaacacatctgcccttgatatggagtttgaacgagccaagtcagctatagagttgcaggcagagttggaggagatggcaaaacgggatgctgaggcccacccctggctttctgactatgatgaccttacgtcagctacctatgataaggggtaccagtttgaggaggagaaccccttgcgtgatcaccctcagccttttgaagaagggctgcggcgccttcaggagggggacctgccaaatgctgtgctgctttttgaggcagctgtgcagcaggatcctaagcacatggaagcttggcagtatctgggtaccacccaggcagagaatgaacaagaactattagccatcagtgcattgcggaggtgtctggagctaaagccagataaccagacagcactgatggcgctggctgtgagcttcaccaacgagtccctgcagcgacaggcctgtgaaaccctacgagactggctgcggtacacaccagcctatgcccatctggtgacacctgctgaagaaggggctggtggggcaggactgggccccagcaagcgtatcctgggatctctcttgtctgactccctgtttcttgaagtgaaagagctcttcctggcagctgtgcggctggaccctacctccattgaccctgatgtgcagtgtggcttgggagtccttttcaacctgagtggggagtatgacaaggccgtggactgcttcacagctgccctcagcgttcgtcccaatgactatttgctgtggaataagctaggcgccaccctggccaatggaaaccagagtgaagaagcagtagctgcgtaccgccgggccctcgagctccagcctggctatatccggtcccgctataacctgggcatcagctgcatcaacctcggggctcaccgggaggctgtggagcactttctggaggccctgaacatgcagaggaaaagccggggcccccggggtgaaggaggtgccatgtcggagaacatctggagcaccctgcgtttggcattgtctatgttaggccagagcgatgcctatggggcagccgacgcgcgggatctgtccaccctcctaactatgtttggcctgccccagtga
Sequence Length
1896
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,291 Da
NCBI Official Full Name
Homo sapiens peroxisomal biogenesis factor 5, mRNA
NCBI Official Synonym Full Names
peroxisomal biogenesis factor 5
NCBI Official Symbol
PEX5
NCBI Official Synonym Symbols
PXR1; PBD2A; PBD2B; PTS1R; RCDP5; PTS1-BP
NCBI Protein Information
peroxisomal biogenesis factor 5
UniProt Protein Name
Peroxisomal targeting signal 1 receptor
Protein Family
UniProt Gene Name
PEX5
UniProt Synonym Gene Names
PXR1; PTS1 receptor; PTS1R
UniProt Entry Name
PEX5_HUMAN

NCBI Description

The product of this gene binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal (SKL-type) and plays an essential role in peroxisomal protein import. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of neonatal adrenoleukodystrophy (NALD), a cause of Zellweger syndrome (ZWS) as well as may be a cause of infantile Refsum disease (IRD). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]

Uniprot Description

PEX5: Binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal (SKL-type) and plays an essential role in peroxisomal protein import. Defects in PEX5 are a cause of adrenoleukodystrophy neonatal (NALD). NALD is a peroxisome biogenesis disorder (PBD) characterized by the accumulation of very long- chain fatty acids, adrenal insufficiency and mental retardation. Inheritance is autosomal recessive. Defects in PEX5 are a cause of Zellweger syndrome (ZWS). ZWS is a fatal peroxisome biogenesis disorder characterized by dysmorphic facial features, hepatomegaly, ocular abnormalities, renal cysts, hearing impairment, profound psychomotor retardation, severe hypotonia and neonatal seizures. Death occurs within the first year of life. Defects in PEX5 may be a cause of infantile Refsum disease (IRD). IRD is a mild peroxisome biogenesis disorder (PBD). Clinical features include early onset, mental retardation, minor facial dysmorphism, retinopathy, sensorineural hearing deficit, hepatomegaly, osteoporosis, failure to thrive, and hypocholesterolemia. The biochemical abnormalities include accumulation of phytanic acid, very long chain fatty acids (VLCFA), di- and trihydroxycholestanoic acid and pipecolic acid. Belongs to the peroxisomal targeting signal receptor family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor, protein translocating; Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13.31

Cellular Component: cytoplasm; membrane; peroxisomal membrane; peroxisome; protein complex

Molecular Function: enzyme binding; peroxisome matrix targeting signal-1 binding; peroxisome targeting sequence binding; protein binding; protein N-terminus binding; small GTPase binding

Biological Process: protein import into peroxisome matrix; protein import into peroxisome matrix, docking; protein import into peroxisome membrane

Disease: Peroxisome Biogenesis Disorder 2a (zellweger); Peroxisome Biogenesis Disorder 2b; Rhizomelic Chondrodysplasia Punctata, Type 5

Research Articles on PEX5

Similar Products

Product Notes

The PEX5 pex5 (Catalog #AAA1277404) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaatgc gggagctggt ggaggccgaa tgcgggggtg ccaacccgct catgaagctc gccgggcact tcacccagga caaggccctt cggcaggagg gattgaggcc tggcccctgg ccccccggag ccccggcctc tgaggcagcc tccaagcctt tgggagtagc ttctgaagat gagttggtgg ctgaattcct gcaggaccag aatgcacccc ttgtgtcccg tgcccctcag accttcaaga tggatgacct cctggctgag atgcagcaga ttgagcagtc aaacttccgc caggctcccc agagagcccc tggtgtggca gacttggcct tgtctgagaa ctgggcccag gagtttcttg cagctggaga tgctgtggat gtaactcagg attataatga gactgactgg tcccaagaat tcatctctga agttacagac cccttgtctg tgtcccctgc ccgctgggct gaggaatatt tggagcaatc agaggagaag ctgtggctgg gagaacctga gggaacagcc accgatcgct ggtatgatga atatcatcct gaggaggatc tgcagcacac ggccagtgac tttgtggcca aagtggatga ccccaaattg gctaattctg agttcctgaa attcgtgcgg cagattggcg aagggcaggt gtccctggag tccggtgcag ggtcgggccg agctcaggca gaacagtggg cagcagagtt tatacagcag cagggtacat cagatgcctg ggttgaccag ttcacaagac cagtaaacac atctgccctt gatatggagt ttgaacgagc caagtcagct atagagttgc aggcagagtt ggaggagatg gcaaaacggg atgctgaggc ccacccctgg ctttctgact atgatgacct tacgtcagct acctatgata aggggtacca gtttgaggag gagaacccct tgcgtgatca ccctcagcct tttgaagaag ggctgcggcg ccttcaggag ggggacctgc caaatgctgt gctgcttttt gaggcagctg tgcagcagga tcctaagcac atggaagctt ggcagtatct gggtaccacc caggcagaga atgaacaaga actattagcc atcagtgcat tgcggaggtg tctggagcta aagccagata accagacagc actgatggcg ctggctgtga gcttcaccaa cgagtccctg cagcgacagg cctgtgaaac cctacgagac tggctgcggt acacaccagc ctatgcccat ctggtgacac ctgctgaaga aggggctggt ggggcaggac tgggccccag caagcgtatc ctgggatctc tcttgtctga ctccctgttt cttgaagtga aagagctctt cctggcagct gtgcggctgg accctacctc cattgaccct gatgtgcagt gtggcttggg agtccttttc aacctgagtg gggagtatga caaggccgtg gactgcttca cagctgccct cagcgttcgt cccaatgact atttgctgtg gaataagcta ggcgccaccc tggccaatgg aaaccagagt gaagaagcag tagctgcgta ccgccgggcc ctcgagctcc agcctggcta tatccggtcc cgctataacc tgggcatcag ctgcatcaac ctcggggctc accgggaggc tgtggagcac tttctggagg ccctgaacat gcagaggaaa agccggggcc cccggggtga aggaggtgcc atgtcggaga acatctggag caccctgcgt ttggcattgt ctatgttagg ccagagcgat gcctatgggg cagccgacgc gcgggatctg tccaccctcc taactatgtt tggcctgccc cagtga. It is sometimes possible for the material contained within the vial of "PEX5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.