Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PERP cdna clone

PERP cDNA Clone

Gene Names
PERP; THW; KCP1; PIGPC1; KRTCAP1; dJ496H19.1
Synonyms
PERP; PERP cDNA Clone; PERP cdna clone
Ordering
For Research Use Only!
Sequence
atgatccgctgcggcctggcctgcgagcgctgccgctggatcctgcccctgctcctactcagcgccatcgccttcgacatcatcgcgctggccggccgcggctggttgcagtctagcgaccacggccagacgtcctcgctgtggtggaaatgctcccaagagggcggcggcagcgggtcctacgaggagggctgtcagagcctcatggagtacgcgtggggtagagcagcggctgccatgctcttctgtggcttcatcatcctggtgatctgtttcatcctctccttcttcgccctctgtggaccccagatgcttgtcttcctgagagtgattggaggtctccttgccttggctgctgtgttccagatcatctccctggtaatttaccccgtgaagtacacccagaccttcacccttcatgccaaccctgctgtcacttacatctataactgggcctacggctttgggtgggcagccacgattatcctgattggctgtgccttcttcttctgctgcctccccaactacgaagatgaccttctgggcaatgccaagcccaggtacttctacacatctgcctaa
Sequence Length
582
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,386 Da
NCBI Official Full Name
Homo sapiens PERP, TP53 apoptosis effector, mRNA
NCBI Official Synonym Full Names
PERP, TP53 apoptosis effector
NCBI Official Symbol
PERP
NCBI Official Synonym Symbols
THW; KCP1; PIGPC1; KRTCAP1; dJ496H19.1
NCBI Protein Information
p53 apoptosis effector related to PMP-22
UniProt Protein Name
p53 apoptosis effector related to PMP-22
Protein Family
UniProt Gene Name
PERP
UniProt Synonym Gene Names
KCP1; KRTCAP1; PIGPC1; THW; KCP-1
UniProt Entry Name
PERP_HUMAN

Uniprot Description

PERP: Component of intercellular desmosome junctions. Plays a role in stratified epithelial integrity and cell-cell adhesion by promoting desmosome assembly. Plays a role as an effector in the TP53-dependent apoptotic pathway. Belongs to the TMEM47 family.

Protein type: Mitochondrial; Cell adhesion; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6q24

Cellular Component: cell junction; plasma membrane

Biological Process: positive regulation of proteolysis; regulation of apoptosis

Research Articles on PERP

Similar Products

Product Notes

The PERP perp (Catalog #AAA1275973) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatccgct gcggcctggc ctgcgagcgc tgccgctgga tcctgcccct gctcctactc agcgccatcg ccttcgacat catcgcgctg gccggccgcg gctggttgca gtctagcgac cacggccaga cgtcctcgct gtggtggaaa tgctcccaag agggcggcgg cagcgggtcc tacgaggagg gctgtcagag cctcatggag tacgcgtggg gtagagcagc ggctgccatg ctcttctgtg gcttcatcat cctggtgatc tgtttcatcc tctccttctt cgccctctgt ggaccccaga tgcttgtctt cctgagagtg attggaggtc tccttgcctt ggctgctgtg ttccagatca tctccctggt aatttacccc gtgaagtaca cccagacctt cacccttcat gccaaccctg ctgtcactta catctataac tgggcctacg gctttgggtg ggcagccacg attatcctga ttggctgtgc cttcttcttc tgctgcctcc ccaactacga agatgacctt ctgggcaatg ccaagcccag gtacttctac acatctgcct aa. It is sometimes possible for the material contained within the vial of "PERP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.