PEF1 cdna clone
PEF1 cDNA Clone
Gene Names
PEF1; ABP32; PEF1A
Synonyms
PEF1; PEF1 cDNA Clone; PEF1 cdna clone
Sequence
atggccagctatccttaccggcagggctgcccaggagctgcaggacaagcaccaggagcccctccgggtagctactaccctggaccccccaatagtggagggcagtatggtagtgggctaccccctggtggtggttatgggggtcctgcccctggagggccttatggaccaccagctggtggagggccctatggacaccccaatcctgggatgttcccctctggaactccaggaggaccatatggcggtgcagctcccgggggcccctatggtcagccacctccaagttcctacggtgcccagcagcctgggctttatggacagggtggcgcccctcccaatgtggatcctgaggcctactcctggttccagtcggtggactcagatcacagtggctatatctccatgaaggagctaaagcaggccctggtcaactgcaattggtcttcattcaatgatgagacctgcctcatgatgataaacatgtttgacaagaccaagtcaggccgcatcgatgtctacggcttctcagccctgtggaaattcatccagcagtggaagaacctcttccagcagtatgaccgggaccgctcgggctccattagctacacagagctgcagcaagctctgtcccaaatgggctacaacctgagcccccagttcacccagcttctggtctcccgctactgcccacgctctgccaatcctgccatgcagcttgaccgcttcatccaggtgtgcacccagctgcaggtgctgacagaggccttccgggagaaggacacagctgtacaaggcaacattcggctcagcttcgaggacttcgtcaccatgacagcttctcggatgctatga
Sequence Length
855
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,381 Da
NCBI Official Full Name
Homo sapiens penta-EF-hand domain containing 1, mRNA
NCBI Official Synonym Full Names
penta-EF-hand domain containing 1
NCBI Official Symbol
PEF1
NCBI Official Synonym Symbols
ABP32; PEF1A
NCBI Protein Information
peflin
UniProt Protein Name
Peflin
Protein Family
UniProt Gene Name
PEF1
UniProt Synonym Gene Names
ABP32
UniProt Entry Name
PEF1_HUMAN
NCBI Description
This gene encodes a calcium-binding protein belonging to the penta-EF-hand protein family. The encoded protein has been shown to form a heterodimer with the programmed cell death 6 gene product and may modulate its function in Ca(2+) signaling. Alternative splicing results in multiple transcript variants and a pseudogene has been identified on chromosome 1.[provided by RefSeq, May 2010]
Uniprot Description
PEF1: Heterodimer; heterodimerizes with PDCD6/ALG2. Dissociates from PDCD6/ALG2 in presence of Ca(2+).
Chromosomal Location of Human Ortholog: 1p34
Cellular Component: cytoplasm
Molecular Function: calcium-dependent cysteine-type endopeptidase activity; protein binding; protein dimerization activity; protein heterodimerization activity
Biological Process: proteolysis; response to calcium ion
Research Articles on PEF1
Similar Products
Product Notes
The PEF1 pef1 (Catalog #AAA1273273) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagct atccttaccg gcagggctgc ccaggagctg caggacaagc accaggagcc cctccgggta gctactaccc tggacccccc aatagtggag ggcagtatgg tagtgggcta ccccctggtg gtggttatgg gggtcctgcc cctggagggc cttatggacc accagctggt ggagggccct atggacaccc caatcctggg atgttcccct ctggaactcc aggaggacca tatggcggtg cagctcccgg gggcccctat ggtcagccac ctccaagttc ctacggtgcc cagcagcctg ggctttatgg acagggtggc gcccctccca atgtggatcc tgaggcctac tcctggttcc agtcggtgga ctcagatcac agtggctata tctccatgaa ggagctaaag caggccctgg tcaactgcaa ttggtcttca ttcaatgatg agacctgcct catgatgata aacatgtttg acaagaccaa gtcaggccgc atcgatgtct acggcttctc agccctgtgg aaattcatcc agcagtggaa gaacctcttc cagcagtatg accgggaccg ctcgggctcc attagctaca cagagctgca gcaagctctg tcccaaatgg gctacaacct gagcccccag ttcacccagc ttctggtctc ccgctactgc ccacgctctg ccaatcctgc catgcagctt gaccgcttca tccaggtgtg cacccagctg caggtgctga cagaggcctt ccgggagaag gacacagctg tacaaggcaa cattcggctc agcttcgagg acttcgtcac catgacagct tctcggatgc tatga. It is sometimes possible for the material contained within the vial of "PEF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
