Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDZD3 cdna clone

PDZD3 cDNA Clone

Gene Names
PDZD3; IKEPP; PDZK2; NHERF4
Synonyms
PDZD3; PDZD3 cDNA Clone; PDZD3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaaagccgcagatctgcaggacacagcctcgttaactctgaagtttaagtttaacccaaagctgggcattgataatcctgtcctctccctggccgaagaccacgacccctatgatccctggagcctggagcggcctcgcttctgtttactgagcaaagaggagggcaagagttttggcttccacctgcagcaggagctgggcagggctgggcatgtggtgtgcagggtggacccaggcacctctgcccagcgccagggtcttcaggaaggagacaggatcctggcggtgaacaatgatgttgtggaacacgaagactatgcggtggtggtacgccgcatccgggccagcagccctcgggtgttgctgacagtattggcacggcatgcacatgacgtggcccgagctcagctgggagaagatgcccacctctgtcccaccctaggcccaggggtccggccccggctgtgccacatagtgaaagatgagggtggttttggcttcagtgtcacccatggcaatcagggtcctttctggttggtgctaagtactggaggagcagctgagcgggcaggggtgccccccggggcccggctgctggaagtgaatgggctttggcagagtggacagcaggtgaccttgctggtggcagggccagaggtggaagaacagtgtcgccagctgggattgcccctggctgcacccctggcagagggctgggcactgcccaccaagccccgctgcctgcacctggagaaagggccccagggttttgggttcctgctccgggaggaaaagggccttgacggtcgccctggacagttcctgtgggaggtggacccgggactgccagccaagaaggctgggatgcaggctggggaccggctggtggctgtggctggggagagcgtggaggggctgggccatgaggagacagtgtccaggatccaggggcagggctcctgtgtctccctcactgtcgtcgaccctgaggcggaccgcttcttcagcatggttcgcctgtccccactcctcttcttggagaacacagaggctcccgcctcgccccagggcagcagctcagcctcactggttgagacagaggacccttcacttgaagacacaagcgtgccttctgtccctcttggctcccgacagtgcttcctgtaccctgggcctggtggcagctatggcttccgactcagttgtgtggccagtgggcctcgtctcttcatctcccaggtgactccaggaggctcagctgcccgggctgggctgcaagtgggagacgtgattctggaagtgaacgggtatcctgttgggggacagaatgacctggagaggcttcagcagctgcctgaggctgagccacccctctgcctgaagctggcagccaggtctctgcggggcttggaagcctggattccccctggggctgcagaggactgggctctggcctcggatctactgtag
Sequence Length
1476
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,105 Da
NCBI Official Full Name
Homo sapiens PDZ domain containing 3, mRNA
NCBI Official Synonym Full Names
PDZ domain containing 3
NCBI Official Symbol
PDZD3
NCBI Official Synonym Symbols
IKEPP; PDZK2; NHERF4
NCBI Protein Information
Na(+)/H(+) exchange regulatory cofactor NHE-RF4
UniProt Protein Name
Na(+)/H(+) exchange regulatory cofactor NHE-RF4
UniProt Gene Name
PDZD3
UniProt Synonym Gene Names
IKEPP; NHERF4; PDZK2; NHERF-4; Na/Pi cotransporter C-terminal-associated protein 2; NaPi-Cap2
UniProt Entry Name
NHRF4_HUMAN

NCBI Description

Guanylyl cyclase C (GCC, or GUCY2C; MIM 601330) produces cGMP following the binding of either endogenous ligands or heat-stable enterotoxins secreted by E. coli and other enteric bacteria. Activation of GCC initiates a signaling cascade that leads to phosphorylation of the cystic fibrosis transmembrane conductance regulator (CFTR; MIM 602421), followed by a net efflux of ions and water into the intestinal lumen. IKEPP is a regulatory protein that associates with GCC and regulates the amount of cGMP produced following receptor stimulation (Scott et al., 2002 [PubMed 11950846]).[supplied by OMIM, Mar 2008]

Uniprot Description

PDZD3: Acts as a regulatory protein that associates with GUCY2C and negatively modulates its heat-stable enterotoxin-mediated activation. Stimulates SLC9A3 activity in the presence of elevated calcium ions. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell adhesion

Chromosomal Location of Human Ortholog: 11q23.3

Cellular Component: apical part of cell; brush border; cytosol; subapical complex

Molecular Function: guanylate cyclase inhibitor activity; ion channel inhibitor activity; protein binding; protein C-terminus binding

Biological Process: negative regulation of cGMP biosynthetic process; receptor guanylyl cyclase signaling pathway; response to toxin

Research Articles on PDZD3

Similar Products

Product Notes

The PDZD3 pdzd3 (Catalog #AAA1267503) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaaag ccgcagatct gcaggacaca gcctcgttaa ctctgaagtt taagtttaac ccaaagctgg gcattgataa tcctgtcctc tccctggccg aagaccacga cccctatgat ccctggagcc tggagcggcc tcgcttctgt ttactgagca aagaggaggg caagagtttt ggcttccacc tgcagcagga gctgggcagg gctgggcatg tggtgtgcag ggtggaccca ggcacctctg cccagcgcca gggtcttcag gaaggagaca ggatcctggc ggtgaacaat gatgttgtgg aacacgaaga ctatgcggtg gtggtacgcc gcatccgggc cagcagccct cgggtgttgc tgacagtatt ggcacggcat gcacatgacg tggcccgagc tcagctggga gaagatgccc acctctgtcc caccctaggc ccaggggtcc ggccccggct gtgccacata gtgaaagatg agggtggttt tggcttcagt gtcacccatg gcaatcaggg tcctttctgg ttggtgctaa gtactggagg agcagctgag cgggcagggg tgccccccgg ggcccggctg ctggaagtga atgggctttg gcagagtgga cagcaggtga ccttgctggt ggcagggcca gaggtggaag aacagtgtcg ccagctggga ttgcccctgg ctgcacccct ggcagagggc tgggcactgc ccaccaagcc ccgctgcctg cacctggaga aagggcccca gggttttggg ttcctgctcc gggaggaaaa gggccttgac ggtcgccctg gacagttcct gtgggaggtg gacccgggac tgccagccaa gaaggctggg atgcaggctg gggaccggct ggtggctgtg gctggggaga gcgtggaggg gctgggccat gaggagacag tgtccaggat ccaggggcag ggctcctgtg tctccctcac tgtcgtcgac cctgaggcgg accgcttctt cagcatggtt cgcctgtccc cactcctctt cttggagaac acagaggctc ccgcctcgcc ccagggcagc agctcagcct cactggttga gacagaggac ccttcacttg aagacacaag cgtgccttct gtccctcttg gctcccgaca gtgcttcctg taccctgggc ctggtggcag ctatggcttc cgactcagtt gtgtggccag tgggcctcgt ctcttcatct cccaggtgac tccaggaggc tcagctgccc gggctgggct gcaagtggga gacgtgattc tggaagtgaa cgggtatcct gttgggggac agaatgacct ggagaggctt cagcagctgc ctgaggctga gccacccctc tgcctgaagc tggcagccag gtctctgcgg ggcttggaag cctggattcc ccctggggct gcagaggact gggctctggc ctcggatcta ctgtag. It is sometimes possible for the material contained within the vial of "PDZD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.