PDS5A cdna clone
PDS5A cDNA Clone
Gene Names
PDS5A; PIG54; SCC112; SCC-112
Synonyms
PDS5A; PDS5A cDNA Clone; PDS5A cdna clone
Sequence
atgattcacctgctagcccatgatccagattttacaagatcacaagatgttgatcagcttcgtgatatcaaagagtgcctatggttcatgcttgaagttttaatgacaaagaatgaaaacaatagccatgcctttatgaagaagatggcagagaacatcaagttaaccagagatgcccagtctccagatgaatccaagacaaatgaaaaactgtatacagtatgtgatgtggctctctgtgttataaatagtaaaagtgctttgtgcaatgcagattcaccaaaggacccagtcctcccaatgaaattttttacacaacctgaaaaggacttctgtaacgataagagttatatttcagaagagacaagagtacttctgttaacaggaaagccaaagcctgctggagtactaggtgcagtaaataagcctttatcagcaacgggaaggaaaccctatgttagaagcactggcactgagactggaagcaatattaatgtaaattcagagctgaacccttcaaccggaaatcgatcaagggaacagagttcagaggcagcagaaactggagttagtgaaaatgaagagaaccctgtgaggattatttcagtcacacctgtaaagaatattgacccagtaaagaataaggaaattaattctgatcaggctacccagggcaacatcagcagtgaccgaggaaagaaaagaacagtaacagcagctggtgcagagaatatccaacaaaaaacagatgagaaagtagatgaatcgggacctcccgccccttccaaacccaggagaggacgtcgacccaagtctgaatctcagggcaatgctaccaaaaatgatgatctaaataaacctattaacaagggaaggaagagagctgcagtgggtcaggagagccctgggggtttggaagcaggtaatgccaaagcacccaaactgcaagatttagccaaaaaggcagcaccagcagaaagacaaattgacttacaaaggtaa
Sequence Length
1002
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
69,000 Da
NCBI Official Full Name
Homo sapiens PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
PDS5 cohesin associated factor A
NCBI Official Symbol
PDS5A
NCBI Official Synonym Symbols
PIG54; SCC112; SCC-112
NCBI Protein Information
sister chromatid cohesion protein PDS5 homolog A
UniProt Protein Name
Sister chromatid cohesion protein PDS5 homolog A
Protein Family
UniProt Gene Name
PDS5A
UniProt Synonym Gene Names
SCC-112
UniProt Entry Name
PDS5A_HUMAN
NCBI Description
The protein encoded by this gene binds to the cohesin complex and associates with chromatin through most of the cell cycle. The encoded protein may play a role in regulating sister chromatid cohesion during mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Uniprot Description
SCC-112: a cell-cycle regulated protein.
Protein type: Cell cycle regulation
Chromosomal Location of Human Ortholog: 4p14
Cellular Component: chromatin; chromosome; chromosome, pericentric region; cytosol; nucleoplasm; plasma membrane
Molecular Function: protein binding
Biological Process: mitotic sister chromatid cohesion; negative regulation of DNA replication; sister chromatid cohesion
Research Articles on PDS5A
Similar Products
Product Notes
The PDS5A pds5a (Catalog #AAA1273081) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattcacc tgctagccca tgatccagat tttacaagat cacaagatgt tgatcagctt cgtgatatca aagagtgcct atggttcatg cttgaagttt taatgacaaa gaatgaaaac aatagccatg cctttatgaa gaagatggca gagaacatca agttaaccag agatgcccag tctccagatg aatccaagac aaatgaaaaa ctgtatacag tatgtgatgt ggctctctgt gttataaata gtaaaagtgc tttgtgcaat gcagattcac caaaggaccc agtcctccca atgaaatttt ttacacaacc tgaaaaggac ttctgtaacg ataagagtta tatttcagaa gagacaagag tacttctgtt aacaggaaag ccaaagcctg ctggagtact aggtgcagta aataagcctt tatcagcaac gggaaggaaa ccctatgtta gaagcactgg cactgagact ggaagcaata ttaatgtaaa ttcagagctg aacccttcaa ccggaaatcg atcaagggaa cagagttcag aggcagcaga aactggagtt agtgaaaatg aagagaaccc tgtgaggatt atttcagtca cacctgtaaa gaatattgac ccagtaaaga ataaggaaat taattctgat caggctaccc agggcaacat cagcagtgac cgaggaaaga aaagaacagt aacagcagct ggtgcagaga atatccaaca aaaaacagat gagaaagtag atgaatcggg acctcccgcc ccttccaaac ccaggagagg acgtcgaccc aagtctgaat ctcagggcaa tgctaccaaa aatgatgatc taaataaacc tattaacaag ggaaggaaga gagctgcagt gggtcaggag agccctgggg gtttggaagc aggtaatgcc aaagcaccca aactgcaaga tttagccaaa aaggcagcac cagcagaaag acaaattgac ttacaaaggt aa. It is sometimes possible for the material contained within the vial of "PDS5A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
