PDLIM4 cdna clone

PDLIM4 cDNA Clone

Gene Names

PDLIM4; RIL

Synonyms

PDLIM4; PDLIM4 cDNA Clone; PDLIM4 cdna clone

Ordering
Cat. Num. AAA1267674 For Research Use Only!

Sequence

atgccccattccgtgaccctgcgcgggccttcgccctggggcttccgcctggtgggcggccgggacttcagcgcgcccctcaccatctcacgggtccatgctggcagcaaggctgcattggctgccctgtgcccaggagacctgatccaggccatcaatggtgagagcacagagctcatgacacacctggaggcacagaaccgcatcaagggctgccacgatcacctcacactgtctgtgagcaggcctgagggcaggagctggcccagtgcccctgatgacagcaaggctcaggcacacaggatccacatcgatcctgagatccaggacggcagcccaacaaccagcagggggccctcaggcaccgggactgggccagaagatggcagaccaagcctgggatctccatatggacaaccccctcgctttccagtccctcacaatggcagcagcgaggccaccctgccagcccagatgagcaccctgcatgtgtctccaccccccagcgctgacccagccagaggcctcccgcggagccgggactgcagagtcgacctgggctccgaggtgtacaggatgctgcgggagccagccgagcccgtggccgcggagcccaagcagtcaggctccttccgctacttgcagggcatgctagaggccggcgagggcggggattggcccgggcctggcggcccccggaacctcaagcccacggccagcaagctgggcgctccgctgagcggcctgcaggggctgcccgagtgcacgcgctgcggccacggcatcgtgggcaccatcgtcaaggcacgggacaagctctaccatcccgagtgcttcatgtgcagtgactgcggcctgaacctcaagcagcgtggttacttctttctggacgagcggctctactgtgagagccacgccaaggcgcgcgtgaagccgcccgagggctacgacgtggtggcggtgtaccccaatgccaaggtggaactcgtctga

Sequence Length

993

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

16876984

NCBI GeneID

8572

Molecular Weight

25,854 Da

NCBI Official Full Name

Homo sapiens PDZ and LIM domain 4, mRNA

NCBI Official Synonym Full Names

PDZ and LIM domain 4

NCBI Official Symbol

PDLIM4

NCBI Official Synonym Symbols

RIL

NCBI Protein Information

PDZ and LIM domain protein 4

UniProt Protein Name

PDZ and LIM domain protein 4

Protein Family

PDZ and LIM domain protein

UniProt Gene Name

PDLIM4

UniProt Synonym Gene Names

RIL

UniProt Entry Name

PDLI4_HUMAN

NCBI Description

This gene encodes a protein which may be involved in bone development. Mutations in this gene are associated with susceptibility to osteoporosis. [provided by RefSeq, Nov 2009]

Uniprot Description

RIL: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 5q31.1

Molecular Function: protein binding

Disease: Osteoporosis

Research Articles on PDLIM4

1. The levels of the EDNRB, HJURP and p60/CAF-1 proteins were strongly associated with overall survival in high-grade gliomas patients (p<0.001, p<0.001 and p=0.002, respectively), whereas the one of PDLI4 was not (P=0.11).

Similar Products

Product Notes

The PDLIM4 pdlim4 (Catalog #AAA1267674) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccatt ccgtgaccct gcgcgggcct tcgccctggg gcttccgcct ggtgggcggc cgggacttca gcgcgcccct caccatctca cgggtccatg ctggcagcaa ggctgcattg gctgccctgt gcccaggaga cctgatccag gccatcaatg gtgagagcac agagctcatg acacacctgg aggcacagaa ccgcatcaag ggctgccacg atcacctcac actgtctgtg agcaggcctg agggcaggag ctggcccagt gcccctgatg acagcaaggc tcaggcacac aggatccaca tcgatcctga gatccaggac ggcagcccaa caaccagcag ggggccctca ggcaccggga ctgggccaga agatggcaga ccaagcctgg gatctccata tggacaaccc cctcgctttc cagtccctca caatggcagc agcgaggcca ccctgccagc ccagatgagc accctgcatg tgtctccacc ccccagcgct gacccagcca gaggcctccc gcggagccgg gactgcagag tcgacctggg ctccgaggtg tacaggatgc tgcgggagcc agccgagccc gtggccgcgg agcccaagca gtcaggctcc ttccgctact tgcagggcat gctagaggcc ggcgagggcg gggattggcc cgggcctggc ggcccccgga acctcaagcc cacggccagc aagctgggcg ctccgctgag cggcctgcag gggctgcccg agtgcacgcg ctgcggccac ggcatcgtgg gcaccatcgt caaggcacgg gacaagctct accatcccga gtgcttcatg tgcagtgact gcggcctgaa cctcaagcag cgtggttact tctttctgga cgagcggctc tactgtgaga gccacgccaa ggcgcgcgtg aagccgcccg agggctacga cgtggtggcg gtgtacccca atgccaaggt ggaactcgtc tga. It is sometimes possible for the material contained within the vial of "PDLIM4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

PDLIM4 cdna clone