PDLIM3 cdna clone
PDLIM3 cDNA Clone
Gene Names
PDLIM3; ALP
Synonyms
PDLIM3; PDLIM3 cDNA Clone; PDLIM3 cdna clone
Sequence
atgccccagacggtgatcctcccgggccctgcgccctggggcttcaggctctcagggggcatagacttcaaccagcctttggtcatcaccaggattacaccaggaagcaaggcggcagctgccaacctgtgtcctggagatgtcatcctggctattgacggctttgggacagagtccatgactcatgctgatgcgcaggacaggattaaagcagcagctcaccagctgtgtctcaaaattgacaggggagaaactcacttatggtctccacaagtatctgaagatgggaaagcccatcctttcaaaatcaacttagaatcagaaccacaggaattcaaacccattggtaccgcgcacaacagaagggcccagccttttgttgcagctgcaaacattgatgacaaaagacaggtagtgagcgcttcctataactcgccaattgggctctattcaactagcaatatacaagatgcgcttcacggacagctgcggggtctcattcctagctcacctcaaaacgagcccacagcctcggtgccccccgagtcggacgtgtaccggatgctccacgacaatcggaatgagcccacacagcctcgccagtcgggctccttcagagtgctccagggaatggtggacgatggctctgatgaccgtccggctggaacgcggagtgtgagagctccggtgacgaaagtccatggcggttcaggcggggcacagaggatgccgctctgtgacaaatgtgggagtggcatagttggtgctgtggtgaaggcgcgggataagtaccggcaccctgagtgcttcgtgtgtgccgactgcaacctcaacctcaagcaaaagggctactttttcatagaaggggagctgtactgcgaaacccacgcaagagcccgcacaaagcccccagagggctatgacacggtcactctgtatcccaaagcttaa
Sequence Length
951
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
20,214 Da
NCBI Official Full Name
Homo sapiens PDZ and LIM domain 3, mRNA
NCBI Official Synonym Full Names
PDZ and LIM domain 3
NCBI Official Symbol
PDLIM3
NCBI Official Synonym Symbols
ALP
NCBI Protein Information
PDZ and LIM domain protein 3
UniProt Protein Name
PDZ and LIM domain protein 3
Protein Family
UniProt Gene Name
PDLIM3
UniProt Synonym Gene Names
ALP
UniProt Entry Name
PDLI3_HUMAN
NCBI Description
The protein encoded by this gene contains a PDZ domain and a LIM domain, indicating that it may be involved in cytoskeletal assembly. In support of this, the encoded protein has been shown to bind the spectrin-like repeats of alpha-actinin-2 and to colocalize with alpha-actinin-2 at the Z lines of skeletal muscle. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Aberrant alternative splicing of this gene may play a role in myotonic dystrophy. [provided by RefSeq, Apr 2012]
Uniprot Description
PDLIM3: May play a role in the organization of actin filament arrays within muscle cells. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Cytoskeletal
Chromosomal Location of Human Ortholog: 4q35
Cellular Component: cytoplasm
Molecular Function: protein binding
Research Articles on PDLIM3
Similar Products
Product Notes
The PDLIM3 pdlim3 (Catalog #AAA1268544) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccaga cggtgatcct cccgggccct gcgccctggg gcttcaggct ctcagggggc atagacttca accagccttt ggtcatcacc aggattacac caggaagcaa ggcggcagct gccaacctgt gtcctggaga tgtcatcctg gctattgacg gctttgggac agagtccatg actcatgctg atgcgcagga caggattaaa gcagcagctc accagctgtg tctcaaaatt gacaggggag aaactcactt atggtctcca caagtatctg aagatgggaa agcccatcct ttcaaaatca acttagaatc agaaccacag gaattcaaac ccattggtac cgcgcacaac agaagggccc agccttttgt tgcagctgca aacattgatg acaaaagaca ggtagtgagc gcttcctata actcgccaat tgggctctat tcaactagca atatacaaga tgcgcttcac ggacagctgc ggggtctcat tcctagctca cctcaaaacg agcccacagc ctcggtgccc cccgagtcgg acgtgtaccg gatgctccac gacaatcgga atgagcccac acagcctcgc cagtcgggct ccttcagagt gctccaggga atggtggacg atggctctga tgaccgtccg gctggaacgc ggagtgtgag agctccggtg acgaaagtcc atggcggttc aggcggggca cagaggatgc cgctctgtga caaatgtggg agtggcatag ttggtgctgt ggtgaaggcg cgggataagt accggcaccc tgagtgcttc gtgtgtgccg actgcaacct caacctcaag caaaagggct actttttcat agaaggggag ctgtactgcg aaacccacgc aagagcccgc acaaagcccc cagagggcta tgacacggtc actctgtatc ccaaagctta a. It is sometimes possible for the material contained within the vial of "PDLIM3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
