Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDGFD cdna clone

PDGFD cDNA Clone

Gene Names
PDGFD; IEGF; SCDGFB; MSTP036; SCDGF-B
Synonyms
PDGFD; PDGFD cDNA Clone; PDGFD cdna clone
Ordering
For Research Use Only!
Sequence
atgcaccggctcatctttgtctacactctaatctgcgcaaacttttgcagctgtcgggacacttctgcaaccccgcagagcgcatccatcaaagctttgcgcaacgccaacctcaggcgagatgacttgtaccgaagagatgagaccatccaggtgaaaggaaacggctacgtgcagagtcctagattcccgaacagctaccccaggaacctgctcctgacatggcggcttcactctcaggagaatacacggatacagctagtgtttgacaatcagtttggattagaggaagcagaaaatgatatctgtaggtatgattttgtggaagttgaagatatatccgaaaccagtaccattattagaggacgatggtgtggacacaaggaagttcctccaaggataaaatcaagaacgaaccaaattaaaatcacattcaagtccgatgactactttgtggctaaacctggattcaagatttattattctttgctggaagatttccaacccgcagcagcttcagagaccaactgggaatctgtcacaagctctatttcaggggtatcctataactctccatcagtaacggatcccactctgattgcggatgctctggacaaaaaaattgcagaatttgatacagtggaagatctgctcaagtacttcaatccagagtcatggcaagaagatcttgagaatatgtatctggacacccctcggtatcgaggcaggtcataccatgaccggaagtcaaaagttgacctggataggctcaatgatgatgccaagcgttacagttgcactcccaggaattactcggtcaatataagagaagagctgaagttggccaatgtggtcttctttccacgttgcctcctcgtgcagcgctgtggaggaaattgtggctgtggaactgtcaactggaggtcctgcacatgcaattcagggaaaaccgtgaaaaagtatcatgaggtattacagtttgagcctggccacatcaagaggaggggtagagctaagaccatggctctagttgacatccagttggatcaccatgaacgatgtgattgtatctgcagctcaagaccacctcgataa
Sequence Length
1095
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,167 Da
NCBI Official Full Name
Homo sapiens platelet derived growth factor D, mRNA
NCBI Official Synonym Full Names
platelet derived growth factor D
NCBI Official Symbol
PDGFD
NCBI Official Synonym Symbols
IEGF; SCDGFB; MSTP036; SCDGF-B
NCBI Protein Information
platelet-derived growth factor D
UniProt Protein Name
Platelet-derived growth factor D
UniProt Gene Name
PDGFD
UniProt Synonym Gene Names
IEGF; SCDGFB; PDGF-D; SCDGF-B; PDGFD latent form; PDGFD receptor-binding form
UniProt Entry Name
PDGFD_HUMAN

NCBI Description

The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines, seven of which are found in this factor. This gene product only forms homodimers and, therefore, does not dimerize with the other three family members. It differs from alpha and beta members of this family in having an unusual N-terminal domain, the CUB domain. Two splice variants have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

PDGFD: Growth factor that plays an essential role in the regulation of embryonic development, cell proliferation, cell migration, survival and chemotaxis. Potent mitogen for cells of mesenchymal origin. Plays an important role in wound healing. Induces macrophage recruitment, increased interstitial pressure, and blood vessel maturation during angiogenesis. Can initiate events that lead to a mesangial proliferative glomerulonephritis, including influx of monocytes and macrophages and production of extracellular matrix. Belongs to the PDGF/VEGF growth factor family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Oncoprotein; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 11q22.3

Cellular Component: endoplasmic reticulum lumen; extracellular region; extracellular space; Golgi membrane

Molecular Function: platelet-derived growth factor receptor binding

Biological Process: blood coagulation; platelet-derived growth factor receptor signaling pathway; positive regulation of cell migration; positive regulation of cell proliferation; positive regulation of MAP kinase activity; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of protein amino acid autophosphorylation

Research Articles on PDGFD

Similar Products

Product Notes

The PDGFD pdgfd (Catalog #AAA1265648) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaccggc tcatctttgt ctacactcta atctgcgcaa acttttgcag ctgtcgggac acttctgcaa ccccgcagag cgcatccatc aaagctttgc gcaacgccaa cctcaggcga gatgacttgt accgaagaga tgagaccatc caggtgaaag gaaacggcta cgtgcagagt cctagattcc cgaacagcta ccccaggaac ctgctcctga catggcggct tcactctcag gagaatacac ggatacagct agtgtttgac aatcagtttg gattagagga agcagaaaat gatatctgta ggtatgattt tgtggaagtt gaagatatat ccgaaaccag taccattatt agaggacgat ggtgtggaca caaggaagtt cctccaagga taaaatcaag aacgaaccaa attaaaatca cattcaagtc cgatgactac tttgtggcta aacctggatt caagatttat tattctttgc tggaagattt ccaacccgca gcagcttcag agaccaactg ggaatctgtc acaagctcta tttcaggggt atcctataac tctccatcag taacggatcc cactctgatt gcggatgctc tggacaaaaa aattgcagaa tttgatacag tggaagatct gctcaagtac ttcaatccag agtcatggca agaagatctt gagaatatgt atctggacac ccctcggtat cgaggcaggt cataccatga ccggaagtca aaagttgacc tggataggct caatgatgat gccaagcgtt acagttgcac tcccaggaat tactcggtca atataagaga agagctgaag ttggccaatg tggtcttctt tccacgttgc ctcctcgtgc agcgctgtgg aggaaattgt ggctgtggaa ctgtcaactg gaggtcctgc acatgcaatt cagggaaaac cgtgaaaaag tatcatgagg tattacagtt tgagcctggc cacatcaaga ggaggggtag agctaagacc atggctctag ttgacatcca gttggatcac catgaacgat gtgattgtat ctgcagctca agaccacctc gataa. It is sometimes possible for the material contained within the vial of "PDGFD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.