Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDE6H cdna clone

PDE6H cDNA Clone

Gene Names
PDE6H; RCD3; ACHM6
Synonyms
PDE6H; PDE6H cDNA Clone; PDE6H cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgacaacactactctgcctgctccagcttcaaaccagggtcctaccaccccacgcaaaggccctcccaagttcaagcagaggcagactcgccaattcaagagtaaacctccaaagaaaggtgtgaaaggatttggagatgacattccaggaatggaggggctaggaacagatatcacagtgatttgtccatgggaggcattcagccacctggaattgcatgagctcgctcagtttgggattatctga
Sequence Length
252
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,074 Da
NCBI Official Full Name
Homo sapiens phosphodiesterase 6H, cGMP-specific, cone, gamma, mRNA
NCBI Official Synonym Full Names
phosphodiesterase 6H
NCBI Official Symbol
PDE6H
NCBI Official Synonym Symbols
RCD3; ACHM6
NCBI Protein Information
retinal cone rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit gamma
UniProt Protein Name
Retinal cone rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit gamma
UniProt Gene Name
PDE6H
UniProt Synonym Gene Names
GMP-PDE gamma
UniProt Entry Name
CNCG_HUMAN

NCBI Description

This gene encodes the inhibitory (or gamma) subunit of the cone-specific cGMP phosphodiesterase, which is a tetramer composed of two catalytic chains (alpha and beta), and two inhibitory chains (gamma). It is specifically expressed in the retina, and is involved in the transmission and amplification of the visual signal. Mutations in this gene are associated with retinal cone dystrophy type 3A (RCD3A). [provided by RefSeq, Mar 2010]

Uniprot Description

PDE6H: Participates in processes of transmission and amplification of the visual signal. cGMP-PDEs are the effector molecules in G-protein-mediated phototransduction in vertebrate rods and cones. Defects in PDE6H are the cause of cone dystrophy retinal type 3A (RCD3A); also known as cone dystrophy with night blindness and supernormal rod responses. RCD3A is a rare form of cone dystrophy associated with supernormal rod responses. The disorder is characterized by reduced visual acuity, photoaversion, night blindness, and abnormal color vision. At an early age, the retina shows subtle depigmentation at the macula and, later, more obvious areas of atrophy. Belongs to the rod/cone cGMP-PDE gamma subunit family.

Protein type: Phosphodiesterase; EC 3.1.4.35; Inhibitor; Nucleotide Metabolism - purine

Chromosomal Location of Human Ortholog: 12p13

Molecular Function: enzyme inhibitor activity; protein binding

Disease: Retinal Cone Dystrophy 3a

Research Articles on PDE6H

Similar Products

Product Notes

The PDE6H pde6h (Catalog #AAA1276242) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgaca acactactct gcctgctcca gcttcaaacc agggtcctac caccccacgc aaaggccctc ccaagttcaa gcagaggcag actcgccaat tcaagagtaa acctccaaag aaaggtgtga aaggatttgg agatgacatt ccaggaatgg aggggctagg aacagatatc acagtgattt gtccatggga ggcattcagc cacctggaat tgcatgagct cgctcagttt gggattatct ga. It is sometimes possible for the material contained within the vial of "PDE6H, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.