Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDE6D cdna clone

PDE6D cDNA Clone

Gene Names
PDE6D; PDED; JBTS22
Synonyms
PDE6D; PDE6D cDNA Clone; PDE6D cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagccaaggacgagcgggccagggagatcctgaggggcttcaaactaaattggatgaaccttcgggatgctgagacagggaagatactctggcaaggaacagaagacctgtctgtccctggtgtggagcatgaagcccgtgttcccaagaaaatcctcaagtgcaaggcagtgtctcgagaacttaatttttcttcgacagaacaaatggaaaaattccgcctggaacaaaaagtttacttcaaagggcaatgcctagaagaatggttcttcgagtttggctttgtgatccctaactccacaaatacctggcagtccttgatagaggcagcacccgagtcccagatgatgccagcaagcgtcttaactgggaacgttatcatagaaacaaagttttttgacgacgatcttcttgtaagcacatccagagtgagacttttctatgtttga
Sequence Length
453
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,420 Da
NCBI Official Full Name
Homo sapiens phosphodiesterase 6D, cGMP-specific, rod, delta, mRNA
NCBI Official Synonym Full Names
phosphodiesterase 6D
NCBI Official Symbol
PDE6D
NCBI Official Synonym Symbols
PDED; JBTS22
NCBI Protein Information
retinal rod rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit delta
UniProt Protein Name
Retinal rod rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit delta
UniProt Gene Name
PDE6D
UniProt Synonym Gene Names
PDED; GMP-PDE delta
UniProt Entry Name
PDE6D_HUMAN

NCBI Description

This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014]

Uniprot Description

PDE6D: Acts as a GTP specific dissociation inhibitor (GDI). Increases the affinity of ARL3 for GTP by several orders of magnitude and does so by decreasing the nucleotide dissociation rate. Stabilizes Arl3-GTP by decreasing the nucleotide dissociation. Belongs to the PDE6D/unc-119 family.

Chromosomal Location of Human Ortholog: 2q35-q36

Cellular Component: cytoplasmic vesicle; cytosol

Molecular Function: GTPase inhibitor activity; protein binding; Rab GTPase binding

Disease: Joubert Syndrome 22

Research Articles on PDE6D

Similar Products

Product Notes

The PDE6D pde6d (Catalog #AAA1274866) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagcca aggacgagcg ggccagggag atcctgaggg gcttcaaact aaattggatg aaccttcggg atgctgagac agggaagata ctctggcaag gaacagaaga cctgtctgtc cctggtgtgg agcatgaagc ccgtgttccc aagaaaatcc tcaagtgcaa ggcagtgtct cgagaactta atttttcttc gacagaacaa atggaaaaat tccgcctgga acaaaaagtt tacttcaaag ggcaatgcct agaagaatgg ttcttcgagt ttggctttgt gatccctaac tccacaaata cctggcagtc cttgatagag gcagcacccg agtcccagat gatgccagca agcgtcttaa ctgggaacgt tatcatagaa acaaagtttt ttgacgacga tcttcttgta agcacatcca gagtgagact tttctatgtt tga. It is sometimes possible for the material contained within the vial of "PDE6D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.