Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDCL2 cdna clone

PDCL2 cDNA Clone

Gene Names
PDCL2; GCPHLP
Synonyms
PDCL2; PDCL2 cDNA Clone; PDCL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggatcccaatgaagatacagaatggaatgacattttaagagatttcggcattcttcctcctaaagaagagtcaaaagatgaaattgaagaaatggttttacgtttacagaaagaagcaatggtgaaaccatttgaaaagatgactcttgcacagctaaaggaagctgaagatgaatttaatgaagaagatatgcaggctgttgaaacatatagaaagaagcggttacaggaatggaaagctcttaagaaaaaacaaaaatttggagaattaagagaaatttctggaaatcagtatgtgaatgaagtcacaaatgcagaagaagatgtgtgggttataattcatctatacagatcaagcatcccaatgtgtttgttggttaaccagcatcttagtcttctagcaagaaagtttccagaaactaaatttgttaaagccatcgtgaatagctgtattcaacactaccatgacaattgtttaccaacaatttttgtgtataaaaatggtcagatagaagccaaattcattggaattatagaatgtggagggataaatctcaagctggaagaacttgaatggaagctagcagaagttggagcaatacagactgatttggaagaaaaccccagaaaagacatggtagatatgatggtatcttcaattagaaacacttctattcatgatgacagtgatagctccaacagtgataatgaaccaaatagagagaaatattcaataaatagcttttag
Sequence Length
753
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,071 Da
NCBI Official Full Name
Homo sapiens phosducin-like 2, mRNA
NCBI Official Synonym Full Names
phosducin like 2
NCBI Official Symbol
PDCL2
NCBI Official Synonym Symbols
GCPHLP
NCBI Protein Information
phosducin-like protein 2
UniProt Protein Name
Phosducin-like protein 2
Protein Family
UniProt Gene Name
PDCL2
UniProt Entry Name
PDCL2_HUMAN

NCBI Description

This gene encodes a member of the phosducin-like protein family and is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin. Members of the phosducin-like protein family have been shown to bind to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]

Uniprot Description

PDCL2: May play a role in germ cell maturation. Belongs to the phosducin family.

Chromosomal Location of Human Ortholog: 4q12

Cellular Component: cytoplasm

Molecular Function: queuine tRNA-ribosyltransferase activity

Biological Process: queuosine biosynthetic process

Research Articles on PDCL2

Similar Products

Product Notes

The PDCL2 pdcl2 (Catalog #AAA1276560) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggatc ccaatgaaga tacagaatgg aatgacattt taagagattt cggcattctt cctcctaaag aagagtcaaa agatgaaatt gaagaaatgg ttttacgttt acagaaagaa gcaatggtga aaccatttga aaagatgact cttgcacagc taaaggaagc tgaagatgaa tttaatgaag aagatatgca ggctgttgaa acatatagaa agaagcggtt acaggaatgg aaagctctta agaaaaaaca aaaatttgga gaattaagag aaatttctgg aaatcagtat gtgaatgaag tcacaaatgc agaagaagat gtgtgggtta taattcatct atacagatca agcatcccaa tgtgtttgtt ggttaaccag catcttagtc ttctagcaag aaagtttcca gaaactaaat ttgttaaagc catcgtgaat agctgtattc aacactacca tgacaattgt ttaccaacaa tttttgtgta taaaaatggt cagatagaag ccaaattcat tggaattata gaatgtggag ggataaatct caagctggaa gaacttgaat ggaagctagc agaagttgga gcaatacaga ctgatttgga agaaaacccc agaaaagaca tggtagatat gatggtatct tcaattagaa acacttctat tcatgatgac agtgatagct ccaacagtga taatgaacca aatagagaga aatattcaat aaatagcttt tag. It is sometimes possible for the material contained within the vial of "PDCL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.