Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PCGF3 cdna clone

PCGF3 cDNA Clone

Gene Names
PCGF3; RNF3; DONG1; RNF3A
Synonyms
PCGF3; PCGF3 cDNA Clone; PCGF3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcgggccacgctgtggggccacctcagtcctgcctgggtcctggtgccttggaccccacgtgcttgtggccaggctgcccctgggcggggccatgtggcctcagaccacaagagcggagctgccctggcccaagcactgcagctgcctgcacccccgggcttcgcagccttgcttgttttctctgaacagcaacagaacagtgttcacagcgattcaaagggtggcattgggttggacgttctgggtacaagccaacctagtcccacgttgtacgtgaatgtttaa
Sequence Length
291
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,748 Da
NCBI Official Full Name
Homo sapiens polycomb group ring finger 3, mRNA
NCBI Official Synonym Full Names
polycomb group ring finger 3
NCBI Official Symbol
PCGF3
NCBI Official Synonym Symbols
RNF3; DONG1; RNF3A
NCBI Protein Information
polycomb group RING finger protein 3
UniProt Protein Name
Polycomb group RING finger protein 3
UniProt Gene Name
PCGF3
UniProt Synonym Gene Names
RNF3; RNF3A
UniProt Entry Name
PCGF3_HUMAN

NCBI Description

The protein encoded by this gene contains a C3HC4 type RING finger, which is a motif known to be involved in protein-protein interactions. The specific function of this protein has not yet been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

PCGF3: Component of a Polycomb group (PcG) multiprotein PRC1- like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 4p16.3

Cellular Component: nucleus; PcG protein complex

Molecular Function: protein binding

Similar Products

Product Notes

The PCGF3 pcgf3 (Catalog #AAA1268461) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcggg ccacgctgtg gggccacctc agtcctgcct gggtcctggt gccttggacc ccacgtgctt gtggccaggc tgcccctggg cggggccatg tggcctcaga ccacaagagc ggagctgccc tggcccaagc actgcagctg cctgcacccc cgggcttcgc agccttgctt gttttctctg aacagcaaca gaacagtgtt cacagcgatt caaagggtgg cattgggttg gacgttctgg gtacaagcca acctagtccc acgttgtacg tgaatgttta a. It is sometimes possible for the material contained within the vial of "PCGF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.