PAQR5 cdna clone
PAQR5 cDNA Clone
Gene Names
PAQR5; MPRG
Synonyms
PAQR5; PAQR5 cDNA Clone; PAQR5 cdna clone
Sequence
atgctgagcctgaagctccccaggctgtttagcatagaccagataccccaggtgttccatgagcaaggcaccctgttcggctaccgccatccacagagttctgccactgcctgcatcctcagccttttccaaatgaccaatgagactctcaacatttggactcacttgctgcccttctggttctttgcatggaggtttgtgactgcactgtatatgacagacatcaagaatgacagctactcctggcccatgcttgtgtacatgtgcaccagctgcgtgtacccacttgtgtccagctgtgcgcacaccttcagctctatgtccaagaatgcccggcacatttgctacttcctggactatggtgccgtcaacctcttcagcctgggctcagccattgcctactctgcatacacgttcccggatgcgctcatgtgcaccactttccatgactactacgtggccctggctgtactgaacaccatcctcagcacaggcctctcctgctactccaggtttcttgaaatccagaagcccagactctgtaaggtgattcgtgtcctcgcctttgcttatccgtacacctgggactccctccccatcttctacaggctattcctgttcccaggggagagtgcacaaaatgaagccacctcgtaccaccagaagcacatgatcatgaccctcctggcctctttcttgtactctgcacatctgccagaacgcctagcccctggacgctttgactacatcggtcacagtcaccagctgtttcacgtgtgtgtgatcctggccacgcacatgcagatggaagccatacttctggacaagactctgaggaaggaatggctcctggccacctccaagcccttctctttctctcagatagctggagccatacttctgtgcatcatcttcagcctcagcaacataatttatttctcagctgctctgtatcggattcccaagccagaattacataaaaaagaaacatga
Sequence Length
993
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,014 Da
NCBI Official Full Name
Homo sapiens progestin and adipoQ receptor family member V, mRNA
NCBI Official Synonym Full Names
progestin and adipoQ receptor family member 5
NCBI Official Symbol
PAQR5
NCBI Official Synonym Symbols
MPRG
NCBI Protein Information
membrane progestin receptor gamma
UniProt Protein Name
Membrane progestin receptor gamma
Protein Family
UniProt Gene Name
PAQR5
UniProt Synonym Gene Names
MPRG; mPR gamma
UniProt Entry Name
MPRG_HUMAN
Uniprot Description
PAQR5: Steroid membrane receptor. Binds progesterone. May be involved in oocyte maturation. Belongs to the ADIPOR family.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 15q23
Cellular Component: plasma membrane
Molecular Function: protein binding; steroid binding; steroid hormone receptor activity
Biological Process: response to steroid hormone stimulus
Research Articles on PAQR5
Similar Products
Product Notes
The PAQR5 paqr5 (Catalog #AAA1276420) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgagcc tgaagctccc caggctgttt agcatagacc agatacccca ggtgttccat gagcaaggca ccctgttcgg ctaccgccat ccacagagtt ctgccactgc ctgcatcctc agccttttcc aaatgaccaa tgagactctc aacatttgga ctcacttgct gcccttctgg ttctttgcat ggaggtttgt gactgcactg tatatgacag acatcaagaa tgacagctac tcctggccca tgcttgtgta catgtgcacc agctgcgtgt acccacttgt gtccagctgt gcgcacacct tcagctctat gtccaagaat gcccggcaca tttgctactt cctggactat ggtgccgtca acctcttcag cctgggctca gccattgcct actctgcata cacgttcccg gatgcgctca tgtgcaccac tttccatgac tactacgtgg ccctggctgt actgaacacc atcctcagca caggcctctc ctgctactcc aggtttcttg aaatccagaa gcccagactc tgtaaggtga ttcgtgtcct cgcctttgct tatccgtaca cctgggactc cctccccatc ttctacaggc tattcctgtt cccaggggag agtgcacaaa atgaagccac ctcgtaccac cagaagcaca tgatcatgac cctcctggcc tctttcttgt actctgcaca tctgccagaa cgcctagccc ctggacgctt tgactacatc ggtcacagtc accagctgtt tcacgtgtgt gtgatcctgg ccacgcacat gcagatggaa gccatacttc tggacaagac tctgaggaag gaatggctcc tggccacctc caagcccttc tctttctctc agatagctgg agccatactt ctgtgcatca tcttcagcct cagcaacata atttatttct cagctgctct gtatcggatt cccaagccag aattacataa aaaagaaaca tga. It is sometimes possible for the material contained within the vial of "PAQR5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
