Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PADI4 cdna clone

PADI4 cDNA Clone

Gene Names
PADI4; PAD; PAD4; PDI4; PDI5; PADI5
Synonyms
PADI4; PADI4 cDNA Clone; PADI4 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccaggggacattgatccgtgtgaccccagagcagcccacccatgccgtgtgtgtgctgggcaccttgactcagcttgacatctgcagctctgcccctgaggactgcacgtccttcagcatcaacgcctccccaggggtggtcgtggatattgcccacagccctccagccaagaagaaatccacaggttcctccacatggcccctggaccctggggtagaggtgaccctgacgatgaaagcggccagtggtagcacaggcgaccagaaggttcagatttcatactacggacccaagactccaccagtcaaagctctactctacctcaccgcggtggaaatctccctgtgcgcagacatcacccgcaccggcaaagtgaagccaaccagagctgtgaaagatcagaggacctggacctggggcccttgtggacagggtgccatcctgctggtgaactgtgacagagacaatctcgaatcttctgccatggactgcgaggatgatgaagtgcttgacagcgaagacctgcaggacatgtcgctgatgaccctgagcacgaagacccccaaggacttcttcacaaaccatacactggtgctccacgtggccaggtctgagatggacaaagtgagggtgtttcaggccacacggggcaaactgtcctccaagtgcagcgtagtcttgggtcccaagtggccctctcactacctgatggtccccggtggaaagcacaacatggacttctacgtggaggccctcgctttcccggacaccgacttcccggggctcattaccctcaccatctccctgctggacacgtccaacctggagctccccgaggctgtggtgttccaagacagcgtggtcttccgcgtggcgccctggatcatgacccccaacacccagcccccgcaggaggtgtacgcgtgcagtatttttgaaaatgaggacttcctgaagtcagtgactactctggccatgaaagccaagtgcaagctgaccatctgccctgaggaggagaacatggatgaccagtggatgcaggatgaaatggagatcggctacatccaagccccacacaaaacactgcccgtggtcttcgactctccaaggaacagaggcctgaaggagtttcccatcaaacgagtgatgggtccagattttggctatgtaactcgagggccccaaacagggggtatcagtggactggactcctttgggaacctggaagtgagccccccagtcacagtcaggggcaaggaatacccgctgggcaggattctcttcggggacagctgttatcccagcaatgacagccggcagatgcaccaggccctgcaggacttcctcagtgcccagcaggtgcaggcccctgtgaagctctattctgactggctgtccgtgggccacgtggacgagttcctgagctttgtgccagcacccgacaggaagggcttccggctgctcctggccagccccaggtcctgctacaaactgttccaggagcagcagaatgagggccacggggaggccctgctgttcgaagggatcaagaaaaaaaaacagcagaaaataaagaacattctgtcaaacaagacattgagagaacataattcatttgtggagagatgcatcgactggaaccgcgagctgctgaagcgggagctgggcctggccgagagtgacatcattgacatcccgcagctcttcaagctcaaagagttctctaaggcggaagcttttttccccaacatggtgaacatgctggtgctagggaagcacctgggcatccccaagcccttcgggcccgtcatcaacggccgctgctgcctggaggagaaggtgtgttccctgctggagccactgggcctccagtgcaccttcatcaacgacttcttcacctaccacatcaggcatggggaggtgcactgcggcaccaacgtgcgcagaaagcccttctccttcaagtggtggaacatggtgccctga
Sequence Length
1992
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,079 Da
NCBI Official Full Name
Homo sapiens peptidyl arginine deiminase, type IV, mRNA
NCBI Official Synonym Full Names
peptidyl arginine deiminase 4
NCBI Official Symbol
PADI4
NCBI Official Synonym Symbols
PAD; PAD4; PDI4; PDI5; PADI5
NCBI Protein Information
protein-arginine deiminase type-4
UniProt Protein Name
Protein-arginine deiminase type-4
UniProt Gene Name
PADI4
UniProt Synonym Gene Names
PAD4; PADI5; PDI5
UniProt Entry Name
PADI4_HUMAN

NCBI Description

This gene is a member of a gene family which encodes enzymes responsible for the conversion of arginine residues to citrulline residues. This gene may play a role in granulocyte and macrophage development leading to inflammation and immune response. [provided by RefSeq, Jul 2008]

Uniprot Description

PADI4: Catalyzes the citrullination/deimination of arginine residues of proteins. Citrullinates histone H3 at 'Arg-8' and/or 'Arg-17' and histone H4 at 'Arg-3', which prevents their methylation by CARM1 and HRMT1L2/PRMT1 and represses transcription. Citrullinates EP300/P300 at 'Arg-2142', which favors its interaction with NCOA2/GRIP1. Genetic variations in PADI4 are a cause of susceptibility to rheumatoid arthritis (RA). It is a systemic inflammatory disease with autoimmune features and a complex genetic component. It primarily affects the joints and is characterized by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures. Could have an important role in the pathogenesis of rheumatoid arthritis by increasing citrullination of proteins in rheumatoid arthritis synovial tissues, leading, in a cytokine-rich milieu, to a break in tolerance to citrullinated peptides processed and presented in the appropriate HLA context. Belongs to the protein arginine deiminase family.

Protein type: Hydrolase; EC 3.5.3.15; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 1p36.13

Cellular Component: cytosol; nucleoplasm; nucleus

Molecular Function: arginine deiminase activity; calcium ion binding; protein binding; protein-arginine deiminase activity

Biological Process: chromatin modification; chromatin remodeling; establishment and/or maintenance of chromatin architecture; nucleosome assembly; peptidyl-citrulline biosynthetic process from peptidyl-arginine; protein modification process; stem cell maintenance

Disease: Rheumatoid Arthritis

Research Articles on PADI4

Similar Products

Product Notes

The PADI4 padi4 (Catalog #AAA1273516) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccagg ggacattgat ccgtgtgacc ccagagcagc ccacccatgc cgtgtgtgtg ctgggcacct tgactcagct tgacatctgc agctctgccc ctgaggactg cacgtccttc agcatcaacg cctccccagg ggtggtcgtg gatattgccc acagccctcc agccaagaag aaatccacag gttcctccac atggcccctg gaccctgggg tagaggtgac cctgacgatg aaagcggcca gtggtagcac aggcgaccag aaggttcaga tttcatacta cggacccaag actccaccag tcaaagctct actctacctc accgcggtgg aaatctccct gtgcgcagac atcacccgca ccggcaaagt gaagccaacc agagctgtga aagatcagag gacctggacc tggggccctt gtggacaggg tgccatcctg ctggtgaact gtgacagaga caatctcgaa tcttctgcca tggactgcga ggatgatgaa gtgcttgaca gcgaagacct gcaggacatg tcgctgatga ccctgagcac gaagaccccc aaggacttct tcacaaacca tacactggtg ctccacgtgg ccaggtctga gatggacaaa gtgagggtgt ttcaggccac acggggcaaa ctgtcctcca agtgcagcgt agtcttgggt cccaagtggc cctctcacta cctgatggtc cccggtggaa agcacaacat ggacttctac gtggaggccc tcgctttccc ggacaccgac ttcccggggc tcattaccct caccatctcc ctgctggaca cgtccaacct ggagctcccc gaggctgtgg tgttccaaga cagcgtggtc ttccgcgtgg cgccctggat catgaccccc aacacccagc ccccgcagga ggtgtacgcg tgcagtattt ttgaaaatga ggacttcctg aagtcagtga ctactctggc catgaaagcc aagtgcaagc tgaccatctg ccctgaggag gagaacatgg atgaccagtg gatgcaggat gaaatggaga tcggctacat ccaagcccca cacaaaacac tgcccgtggt cttcgactct ccaaggaaca gaggcctgaa ggagtttccc atcaaacgag tgatgggtcc agattttggc tatgtaactc gagggcccca aacagggggt atcagtggac tggactcctt tgggaacctg gaagtgagcc ccccagtcac agtcaggggc aaggaatacc cgctgggcag gattctcttc ggggacagct gttatcccag caatgacagc cggcagatgc accaggccct gcaggacttc ctcagtgccc agcaggtgca ggcccctgtg aagctctatt ctgactggct gtccgtgggc cacgtggacg agttcctgag ctttgtgcca gcacccgaca ggaagggctt ccggctgctc ctggccagcc ccaggtcctg ctacaaactg ttccaggagc agcagaatga gggccacggg gaggccctgc tgttcgaagg gatcaagaaa aaaaaacagc agaaaataaa gaacattctg tcaaacaaga cattgagaga acataattca tttgtggaga gatgcatcga ctggaaccgc gagctgctga agcgggagct gggcctggcc gagagtgaca tcattgacat cccgcagctc ttcaagctca aagagttctc taaggcggaa gcttttttcc ccaacatggt gaacatgctg gtgctaggga agcacctggg catccccaag cccttcgggc ccgtcatcaa cggccgctgc tgcctggagg agaaggtgtg ttccctgctg gagccactgg gcctccagtg caccttcatc aacgacttct tcacctacca catcaggcat ggggaggtgc actgcggcac caacgtgcgc agaaagccct tctccttcaa gtggtggaac atggtgccct ga. It is sometimes possible for the material contained within the vial of "PADI4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.