PADI2 cdna clone
PADI2 cDNA Clone
Synonyms
PADI2; PADI2 cDNA Clone; PADI2 cdna clone
Sequence
atgctgcgcgagcggaccgtgcggctgcagtacgggagccgcgtggaggcggtgtacgtgctgggcacctacctctggaccgatgtctacagcgcggccccagccggggcccaaaccttcagcctgaagcactcggaacacgtgtgggtggaggtggtgcgtgatggggaggctgaggaggtggccaccaatggcaagcagcgctggcttctctcgcccagcaccaccctgcgggtcaccatgagccaggcgagcaccgaggccagcagtgacaaggtcaccgtcaactactatgacgaggaagggagcattcccatcgaccaggcggggctcttcctcacagccattgagatctccctggatgtggacgcagaccgggatggtgtggtggagaagaacaacccaaagaaggcatcctggacctggggccccgagggccagggggccatcctgctggtgaactgtgaccgagagacaccctggttgcccaaggaggactgccgtgatgagaaggtctacagcaaggaagatctcaaggacatgtcccagatgatcctgcggaccaaaggccccgaccgcctccccgccggatacgagatagttctgtacatttccatgtcagactcagacaaagtgggcgtgttctacgtggagaacccgttcttcggccaacgctatatccacatcctgggccggcggaagctctaccatgtggtcaagtacacgggtggctccgcggagctgctgttcttcgtggaaggcctctgtttccccgacgagggcttctcaggcctggtctccatccatgtcagcctgctggagtacatggcccaggacattcccctgactcccatcttcacggacaccgtgatattccggattgctccgtggatcatgacccccaacatcctgcctcccgtgtcggtgtttgtgtgctgcatgaaggataattacctgttcctgaaagaggtgaagaaccttgtggagaaaaccaactgtgagctgaaggtctgcttccagtacctaaaccgaggcgatcgctggatccaggatgaaattgagtttggctacatcgaggccccccataaaggcttccccgtggtgctggactctccccgagatggaaacctaaaggacttccctgtgaaggagctcctgggcccagattttggctacgtgacccgggagcccctctttgagtctgtcaccagccttgactcatttggaaacctggaggtcagtcccccagtgaccgtgaatggcaagacatacccgcttggccgcatcctcatcgggagcagctttcctctgtaa
Sequence Length
1314
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
49,310 Da
NCBI Official Full Name
Homo sapiens peptidyl arginine deiminase, type II, mRNA
UniProt Protein Name
Protein-arginine deiminase type-2
Protein Family
UniProt Gene Name
PADI2
UniProt Synonym Gene Names
KIAA0994; PAD2; PDI2
UniProt Entry Name
PADI2_HUMAN
Uniprot Description
PADI2: Catalyzes the deimination of arginine residues of proteins. Belongs to the protein arginine deiminase family.
Protein type: Hydrolase; EC 3.5.3.15
Chromosomal Location of Human Ortholog: 1p36.13
Cellular Component: cytoplasm; cytosol
Molecular Function: estrogen receptor binding; protein-arginine deiminase activity
Biological Process: chromatin-mediated maintenance of transcription; establishment and/or maintenance of chromatin architecture; estrogen receptor signaling pathway; peptidyl-citrulline biosynthetic process from peptidyl-arginine; substantia nigra development
Similar Products
Product Notes
The PADI2 padi2 (Catalog #AAA1273568) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcgcg agcggaccgt gcggctgcag tacgggagcc gcgtggaggc ggtgtacgtg ctgggcacct acctctggac cgatgtctac agcgcggccc cagccggggc ccaaaccttc agcctgaagc actcggaaca cgtgtgggtg gaggtggtgc gtgatgggga ggctgaggag gtggccacca atggcaagca gcgctggctt ctctcgccca gcaccaccct gcgggtcacc atgagccagg cgagcaccga ggccagcagt gacaaggtca ccgtcaacta ctatgacgag gaagggagca ttcccatcga ccaggcgggg ctcttcctca cagccattga gatctccctg gatgtggacg cagaccggga tggtgtggtg gagaagaaca acccaaagaa ggcatcctgg acctggggcc ccgagggcca gggggccatc ctgctggtga actgtgaccg agagacaccc tggttgccca aggaggactg ccgtgatgag aaggtctaca gcaaggaaga tctcaaggac atgtcccaga tgatcctgcg gaccaaaggc cccgaccgcc tccccgccgg atacgagata gttctgtaca tttccatgtc agactcagac aaagtgggcg tgttctacgt ggagaacccg ttcttcggcc aacgctatat ccacatcctg ggccggcgga agctctacca tgtggtcaag tacacgggtg gctccgcgga gctgctgttc ttcgtggaag gcctctgttt ccccgacgag ggcttctcag gcctggtctc catccatgtc agcctgctgg agtacatggc ccaggacatt cccctgactc ccatcttcac ggacaccgtg atattccgga ttgctccgtg gatcatgacc cccaacatcc tgcctcccgt gtcggtgttt gtgtgctgca tgaaggataa ttacctgttc ctgaaagagg tgaagaacct tgtggagaaa accaactgtg agctgaaggt ctgcttccag tacctaaacc gaggcgatcg ctggatccag gatgaaattg agtttggcta catcgaggcc ccccataaag gcttccccgt ggtgctggac tctccccgag atggaaacct aaaggacttc cctgtgaagg agctcctggg cccagatttt ggctacgtga cccgggagcc cctctttgag tctgtcacca gccttgactc atttggaaac ctggaggtca gtcccccagt gaccgtgaat ggcaagacat acccgcttgg ccgcatcctc atcgggagca gctttcctct gtaa. It is sometimes possible for the material contained within the vial of "PADI2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
