PADI1 cdna clone
PADI1 cDNA Clone
Gene Names
PADI1; PDI; PAD1; PDI1; HPAD10
Synonyms
PADI1; PADI1 cDNA Clone; PADI1 cdna clone
Sequence
atggccccaaagagagttgtgcagctgtccctgaagatgcctacccatgccgtgtgtgtggtgggagtcgaggcacatgtggacattcacagtgatgtgcccaagggtgccaacagcttcagggtctctggaagctccggggtggaggtcttcatggtctacaaccgcacacgtgtgaaagagcccataggcaaggcccgttggccgctagacactgatgcagacatggtcgtatctgtgggcacagccagtaaggaattaaaggacttcaaggtgagggtctcctactttggggagcaggaagaccaagctctgggccgcagcgtgctttacctcactggcgtcgatatttcccttgaggttgacacaggccgcacaggcaaggtgaagaggagccaaggggacaagaaaacctggcgctggggccctgagggctatggggctatcttgctggtgaactgtgaccgggacaatcacaggtccgcagagcctgacctcacccacagctggctgatgtcgctggctgacctgcaggacatgtccccaatgctgctgagctgcaatggccccgacaagctcttcgacagccacaagcttgtcttgaacgtgcccttttctgattccaaaagagtgagggtcttctgtgccaggggtgggaattctctctcggactacaaacaggtgctggggccccagtgtctgtcctatgaagttgagcgacagccaggggagcaggagatcaagttctatgtggaggggctgaccttccccgatgccgatttcctagggctggtttccctcagtgtcagcctggtggacccggggaccctgcccgaggtgaccctcttcacagacactgtgggcttccgcatggccccctggatcatgacgcccaacactcagcctcctgaggagctgtatgtgtgcagagtgatggacactcatggctccaatgagaaattcctggaggacatgtcttatctgacattgaaagccaactgcaagctgaccatctgccctcaagttgaaaatcgaaatgaccgctggatccaggacgagatggagtttggctacatcgaggcccctcacaaatccttccccgtggtctttgactccccccggaacaggggcctgaaagatttcccctataagaggatcctgggtcctgactttggatatgttacccgggagatcccgctccctggtccctccagccttgactccttcggcaacctggacgtcagcccgcccgtcacggtgggcggcacggaataccccctgggccggatcctcatcgggagcagcttccccaagtccggtgggcggcagatggccagggcagtgcggaacttcctgaaggcacagcaggtgcaggcacccgtggagctctactcggactggctctctgtgggccatgtggacgagtttctgacctttgtgcctacctctgaccaaaagggcttccggctgctcctggctagccccagcgcttgcctcaaactcttccaagagaagaaagaagagggttatggggaggcagcccagtttgatgggttaaaacaccaggcaaaaagaagcattaatgagatgctggcagacagacacctccagagagacaatcttcatgcacagaaatgcattgactggaaccgtaatgtgctgaagcgggagctgggcctggcagagagtgacatcgtggacattccccagctcttcttcctgaaaaacttctacgcggaagccttcttcccagacatggttaacatggtggtcttaggcaagtacctgggcatccccaagccctacgggcccatcatcaatggccgctgctgcctggaggagaaggtgcagtccctgctggagcctctgggcctgcactgcatcttcattgatgactacttgtcctaccacgagctgcagggggagatccactgtggcaccaacgtgcgcaggaagccctttcccttcaaatggtggaacatggtgccctga
Sequence Length
1992
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
74,666 Da
NCBI Official Full Name
Homo sapiens peptidyl arginine deiminase, type I, mRNA
NCBI Official Synonym Full Names
peptidyl arginine deiminase 1
NCBI Official Symbol
PADI1
NCBI Official Synonym Symbols
PDI; PAD1; PDI1; HPAD10
NCBI Protein Information
protein-arginine deiminase type-1
UniProt Protein Name
Protein-arginine deiminase type-1
Protein Family
UniProt Gene Name
PADI1
UniProt Synonym Gene Names
PAD1; PDI1
UniProt Entry Name
PADI1_HUMAN
NCBI Description
This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type I enzyme is involved in the late stages of epidermal differentiation, where it deiminates filaggrin and keratin K1, which maintains hydration of the stratum corneum, and hence the cutaneous barrier function. This enzyme may also play a role in hair follicle formation. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
Uniprot Description
PADI1: Catalyzes the deimination of arginine residues of proteins. Epidermis, prostate, testis, placenta, spleen and thymus. Belongs to the protein arginine deiminase family.
Protein type: EC 3.5.3.15; Hydrolase
Chromosomal Location of Human Ortholog: 1p36.13
Cellular Component: cytosol
Biological Process: establishment and/or maintenance of chromatin architecture
Research Articles on PADI1
Similar Products
Product Notes
The PADI1 padi1 (Catalog #AAA1270318) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccccaa agagagttgt gcagctgtcc ctgaagatgc ctacccatgc cgtgtgtgtg gtgggagtcg aggcacatgt ggacattcac agtgatgtgc ccaagggtgc caacagcttc agggtctctg gaagctccgg ggtggaggtc ttcatggtct acaaccgcac acgtgtgaaa gagcccatag gcaaggcccg ttggccgcta gacactgatg cagacatggt cgtatctgtg ggcacagcca gtaaggaatt aaaggacttc aaggtgaggg tctcctactt tggggagcag gaagaccaag ctctgggccg cagcgtgctt tacctcactg gcgtcgatat ttcccttgag gttgacacag gccgcacagg caaggtgaag aggagccaag gggacaagaa aacctggcgc tggggccctg agggctatgg ggctatcttg ctggtgaact gtgaccggga caatcacagg tccgcagagc ctgacctcac ccacagctgg ctgatgtcgc tggctgacct gcaggacatg tccccaatgc tgctgagctg caatggcccc gacaagctct tcgacagcca caagcttgtc ttgaacgtgc ccttttctga ttccaaaaga gtgagggtct tctgtgccag gggtgggaat tctctctcgg actacaaaca ggtgctgggg ccccagtgtc tgtcctatga agttgagcga cagccagggg agcaggagat caagttctat gtggaggggc tgaccttccc cgatgccgat ttcctagggc tggtttccct cagtgtcagc ctggtggacc cggggaccct gcccgaggtg accctcttca cagacactgt gggcttccgc atggccccct ggatcatgac gcccaacact cagcctcctg aggagctgta tgtgtgcaga gtgatggaca ctcatggctc caatgagaaa ttcctggagg acatgtctta tctgacattg aaagccaact gcaagctgac catctgccct caagttgaaa atcgaaatga ccgctggatc caggacgaga tggagtttgg ctacatcgag gcccctcaca aatccttccc cgtggtcttt gactcccccc ggaacagggg cctgaaagat ttcccctata agaggatcct gggtcctgac tttggatatg ttacccggga gatcccgctc cctggtccct ccagccttga ctccttcggc aacctggacg tcagcccgcc cgtcacggtg ggcggcacgg aataccccct gggccggatc ctcatcggga gcagcttccc caagtccggt gggcggcaga tggccagggc agtgcggaac ttcctgaagg cacagcaggt gcaggcaccc gtggagctct actcggactg gctctctgtg ggccatgtgg acgagtttct gacctttgtg cctacctctg accaaaaggg cttccggctg ctcctggcta gccccagcgc ttgcctcaaa ctcttccaag agaagaaaga agagggttat ggggaggcag cccagtttga tgggttaaaa caccaggcaa aaagaagcat taatgagatg ctggcagaca gacacctcca gagagacaat cttcatgcac agaaatgcat tgactggaac cgtaatgtgc tgaagcggga gctgggcctg gcagagagtg acatcgtgga cattccccag ctcttcttcc tgaaaaactt ctacgcggaa gccttcttcc cagacatggt taacatggtg gtcttaggca agtacctggg catccccaag ccctacgggc ccatcatcaa tggccgctgc tgcctggagg agaaggtgca gtccctgctg gagcctctgg gcctgcactg catcttcatt gatgactact tgtcctacca cgagctgcag ggggagatcc actgtggcac caacgtgcgc aggaagccct ttcccttcaa atggtggaac atggtgccct ga. It is sometimes possible for the material contained within the vial of "PADI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
