Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PACSIN2 cdna clone

PACSIN2 cDNA Clone

Gene Names
PACSIN2; SDPII
Synonyms
PACSIN2; PACSIN2 cDNA Clone; PACSIN2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgtcacatatgatgattccgttggagtagaagtgtccagcgacagcttctgggaggtcgggaactacaagcggactgtgaagcggatcgacgatggccaccgcctgtgcagcgacctcatgaactgcctgcatgagcgggcgcgcatcgagaaggcgtatgcgcagcagctcactgagtgggcccggcgctggaggcagctcgtggagaaagggccccagtacgggaccgtggagaaggcctggatggccttcatgtccgaggcagagagggtgagcgagctgcacctcgaggtgaaggcctcactgatgaacgatgacttcgagaagatcaagaactggcagaaggaagcctttcacaagcagatgatgggcggcttcaaggagaccaaggaagctgaggacggctttcggaaggcacagaagccctgggccaagaagctgaaagaggtagaagcagcaaagaaagcccaccatgcagcgtgcaaagaggagaagctggctatctcacgagaagccaacagcaaggcagacccatccctcaaccctgaacagctcaagaaattgcaagacaaaatagaaaagtgcaagcaagatgttcttaagaccaaagagaagtatgagaagtccctgaaggaactcgaccagggcacaccccagtacatggagaacatggagcaggtgtttgagcagtgccagcagttcgaggagaaacgccttcgcttcttccgggaggttctgctggaggttcagaagcacctagacctgtccaatgtggctggctacaaagccatttaccatgacctggagcagagcatcagagcagctgatgcagtggaggacctgaggtggttccgagccaatcacgggccgggcatggccatgaactggccgcagtttgaggagtggtccgcagacctgaatcgaaccctcagccggagagagaagaagaaggccactgacggcgtcaccctgacgggcatcaaccagacaggcgaccagtctctgccgagtaagcccagcagcacccttaatgtcccgagcaaccccgcccagtctgcgcagtcacagtccagctacaaccccttcgaggatgaggacgacacgggcagcaccgtcagtgagaaggacgacactaaggccaaaaatgtgagcagctacgagaagacccagagctatcccaccgactggtcagacgatgagtctaacaaccccttctcctccacggatgccaatggggactcgaatccattcgacgacgacgccacctcggggacggaagtgcgagtccgggccctgtatgactatgaggggcaggagcatgatgagctgagcttcaaggctggggatgagctgaccaagatggaggacgaggatgagcagggctggtgcaagggacgcttggacaacgggcaagttggcctatacccggcaaattatgtggaggcgatccagtga
Sequence Length
1461
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,353 Da
NCBI Official Full Name
Homo sapiens protein kinase C and casein kinase substrate in neurons 2, mRNA
NCBI Official Synonym Full Names
protein kinase C and casein kinase substrate in neurons 2
NCBI Official Symbol
PACSIN2
NCBI Official Synonym Symbols
SDPII
NCBI Protein Information
protein kinase C and casein kinase substrate in neurons protein 2
UniProt Protein Name
Protein kinase C and casein kinase substrate in neurons protein 2
UniProt Gene Name
PACSIN2
UniProt Entry Name
PACN2_HUMAN

NCBI Description

This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation by regulating tubulin polymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]

Uniprot Description

PACSIN2: May play a role in vesicle formation and transport. Belongs to the PACSIN family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 22q13.2-q13.33

Cellular Component: caveola; cell-cell adherens junction; cytoplasm; extrinsic to membrane; focal adhesion; intracellular membrane-bound organelle; nucleoplasm; recycling endosome membrane

Molecular Function: identical protein binding; protein binding; transporter activity

Biological Process: cell projection morphogenesis; regulation of endocytosis

Research Articles on PACSIN2

Similar Products

Product Notes

The PACSIN2 pacsin2 (Catalog #AAA1270692) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgtca catatgatga ttccgttgga gtagaagtgt ccagcgacag cttctgggag gtcgggaact acaagcggac tgtgaagcgg atcgacgatg gccaccgcct gtgcagcgac ctcatgaact gcctgcatga gcgggcgcgc atcgagaagg cgtatgcgca gcagctcact gagtgggccc ggcgctggag gcagctcgtg gagaaagggc cccagtacgg gaccgtggag aaggcctgga tggccttcat gtccgaggca gagagggtga gcgagctgca cctcgaggtg aaggcctcac tgatgaacga tgacttcgag aagatcaaga actggcagaa ggaagccttt cacaagcaga tgatgggcgg cttcaaggag accaaggaag ctgaggacgg ctttcggaag gcacagaagc cctgggccaa gaagctgaaa gaggtagaag cagcaaagaa agcccaccat gcagcgtgca aagaggagaa gctggctatc tcacgagaag ccaacagcaa ggcagaccca tccctcaacc ctgaacagct caagaaattg caagacaaaa tagaaaagtg caagcaagat gttcttaaga ccaaagagaa gtatgagaag tccctgaagg aactcgacca gggcacaccc cagtacatgg agaacatgga gcaggtgttt gagcagtgcc agcagttcga ggagaaacgc cttcgcttct tccgggaggt tctgctggag gttcagaagc acctagacct gtccaatgtg gctggctaca aagccattta ccatgacctg gagcagagca tcagagcagc tgatgcagtg gaggacctga ggtggttccg agccaatcac gggccgggca tggccatgaa ctggccgcag tttgaggagt ggtccgcaga cctgaatcga accctcagcc ggagagagaa gaagaaggcc actgacggcg tcaccctgac gggcatcaac cagacaggcg accagtctct gccgagtaag cccagcagca cccttaatgt cccgagcaac cccgcccagt ctgcgcagtc acagtccagc tacaacccct tcgaggatga ggacgacacg ggcagcaccg tcagtgagaa ggacgacact aaggccaaaa atgtgagcag ctacgagaag acccagagct atcccaccga ctggtcagac gatgagtcta acaacccctt ctcctccacg gatgccaatg gggactcgaa tccattcgac gacgacgcca cctcggggac ggaagtgcga gtccgggccc tgtatgacta tgaggggcag gagcatgatg agctgagctt caaggctggg gatgagctga ccaagatgga ggacgaggat gagcagggct ggtgcaaggg acgcttggac aacgggcaag ttggcctata cccggcaaat tatgtggagg cgatccagtg a. It is sometimes possible for the material contained within the vial of "PACSIN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.